1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
san4es73 [151]
3 years ago
10

What is the importance of codons differing in the last nitrogenous base (ex. CUU, CUC both coding for leucine) but still being a

ble to code for the same amino acid?
Biology
1 answer:
Igoryamba3 years ago
3 0

This characteristic is called redundancy.

Redundancy is one of the characteristics of the genetic code, meaning that there may be several triplets (or codons) that code for the same amino acid. And these codons differ in the third nucleotide of the codon.

This characteristic has an interest in the conservation of protein sequences in case of mutations (we will have silent mutations that will not change the amino acid sequence).

It also has another interest that is to fill all possible combinations of codons: there are 64 different codons coding for 20 amino acids.

You might be interested in
What virus can infects only cats
anastassius [24]

Answer:

Feline Immunodeficiency Virus

Explanation:

8 0
3 years ago
Which domain do we belong to? what characteristics do we have that put us in this domain
Fantom [35]
Mammals? Is that what your asking
4 0
3 years ago
Read 2 more answers
Identify five people whom you consider to be mature
masya89 [10]
In general for everyone, these are the most likely group of people i've chosen mature; grandparents(grandma,granddad), parents (mom,dad), your teacher.
3 0
3 years ago
Helppppppppppppppppppppppppppppppppppppppp
riadik2000 [5.3K]
C) composition of soil
7 0
2 years ago
What are some features of birds that reflect how they may have evolved from dinosaurs
ankoles [38]

Some features might be feathers, thin bones, they are lighter to make flying easier.

8 0
3 years ago
Other questions:
  • If a star fish loses an arm it can__________itself, the arms work__________of each other.
    14·2 answers
  • What are the physical properties of slime?
    15·1 answer
  • Which planet does NOT have a moon orbiting it? A) earth B) jupiter C) mercury D) saturn
    6·2 answers
  • What ?????...........
    8·2 answers
  • What is Geomagnetism?​
    14·2 answers
  • Contrast primary succession and secondary succession. Give an<br> example of each.
    15·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • What is the insertion site of the gracilis muscle?
    10·1 answer
  • Can someone help me plz(asap)? i will give brainliest.
    8·2 answers
  • I need desperate help.​
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!