1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slavikrds [6]
3 years ago
12

(WILL GIVE BRAINLIST)

Biology
1 answer:
AfilCa [17]3 years ago
4 0

Answer:

In my opinion it is the main control center of the body.

You might be interested in
What is the phenotype of a plant with the genotype RR
vazorg [7]
To give a direct answer, I’d have to know what gene we were looking at. However, in a general sense, when a genotype has two capital letters, it means that it’s homozygous dominant. Take for example:

R= tall stalk
r= short stalk

The uppercase R is a dominant allele, which means if the plant has the gene with this in it (RR or Rr) then it will have that trait. If it has two lowercase letters (rr) then it will be the recessive trait.

Using this example, RR would be the tall stalk. For whatever your question is, the dominant phenotype would be the answer.
8 0
3 years ago
Read 2 more answers
The rock below is in Whistler, Canada. What type of weathering is illustrated here?
MArishka [77]
Weathering is the process by which rocks are broken down into smaller particles as a result of physical and chemical changes that are occurring in them. There are three major types of weathering these are: physical, chemical and biological weathering. 
For the question given above, the type of weathering that is occurring in the picture of the given rock is PHYSICAL WEATHERING.
Physical weathering is the type of weathering in which the affected rock is changed in size and shape by means of some agents. The broken particles are usually of the same composition as the parent rock. The agents of physical weathering include: ice, plant roots, animal activities, abrasion and exfoliation. Physically weathered rocks are usually round in shape as a result of the abrasion process which they have undergone.<span />
6 0
3 years ago
Read 2 more answers
According to MyPlate, an adult age 18 or older should consume how many cups of milk or milk equivalents per day on a 2,000-calor
kondaur [170]

Answer:

3

Explanation:

Daily Recomendation

Children

2-3 years old ---2 cups

4-8 years old ---2½ cups

Girls

9-13 years old ---3 cups

14-18 years old ---3 cups

Boys

9-13 years old ---3 cups

14-18 years old ---3 cups

Women

19-30 years ---3 cups

31-50 years old ---3 cups

51+ years old ---3 cups

Men

19-30 years old ---3 cups

31-50 years old ---3 cups

51+ old years old ---3 cups

Cup Equivalents for Milk and Milk Products:

1 cup of milk, yogurt, or soymilk— gives 1 cup equivalent

1.5 ounces of natural cheese— gives 1 cup equivalent

2 ounces of processed cheese— gives 1 cup equivalent

8 0
3 years ago
URGENT URGENT URGENT HELP ME PLS <br> List and describe ways to reduce human footprint on Earth.
svp [43]

Answer:

Taking shorter showers

Don't leave appliances running if you're not using them

Turn off lights after leaving a room

Eating less meat

Using renewable energy/ resources

Driving less

3 0
3 years ago
Read 2 more answers
Which causes a sea breeze?
vodka [1.7K]

The wind will blow from the higher pressure over the water to lower pressure over the land causing the sea breeze.

This causes the low surface pressure to shift to over the ocean during the night and the high surface pressure to move over the land.

<h2><u><em>Air above land warms quicker than air over water.</em></u></h2>
6 0
3 years ago
Read 2 more answers
Other questions:
  • What mineral is most likely used to make an MP3 player? A) talc B) zinc C) quartz D) calcium I'm pretty sure it's either zinc or
    5·2 answers
  • What is independent variable in do wounds heal faster when they are covered by band-aids?
    12·1 answer
  • What term describes the way an organism responds to stimuli?
    15·2 answers
  • All of the elephants living in a wildlife preserve would be considered a
    9·2 answers
  • Invasive species always have negative impacts to the ecosystem in which they are introduced. Question 15 options: True False
    14·1 answer
  • Which is NOT an abiotic factor? <br> moisture<br> flowers<br> temperature<br> pressure
    11·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which statements describe long-term environmental changes? Check all that apply
    7·1 answer
  • Human egg and sperm are similar in that ________.a. they have the same degree of motilityb. they have the same number of chromos
    7·1 answer
  • Squamous cell carcinoma. A/an _____ also called a solar keratosis, is precancerous skin growth that occurs on sun-damaged skin.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!