1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amm1812
3 years ago
7

What was most likely food source for the first TELR APODS

Biology
1 answer:
ArbitrLikvidat [17]3 years ago
4 0

Answer:

eating insects by humans The eggs, larvae, pupae,

Explanation:

You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Mammals do not live in the tundra, because the climate is too extreme. Please select the best answer from the choices provided T
Ivanshal [37]

my guess is False i think that is the correct answer, because their are mammals that live in the tundra.

5 0
3 years ago
Read 2 more answers
Assume that the mother's genotype is AZ/az, and the father's genotype is Az/aZ, and the recombination rate is 10%. What are the
attashe74 [19]

Answer:

0.45 from mom and 0.05 from dad.

Explanation:

The recombinant progeny might occur due to the crossing over at the time of meiosis in which the exchange of chromosomes occur in the homologous chromosomes of non sister chromatids.

The progeny receives half of their chromosome from the mother and half from the father. The mother 50% AZ and 50% az chromosomes respectively. The 10% recombination has occured due to which the mother chromosomes is reduce upto 45%. The recombinant  10% will be aZ and Az and has 5% frequency. Mom has the ability of az chromosomes is 0.45 %. The father has the genotype 50% Az and 50% aZ. The 10% recombination has occured due to which the father chromosomes is reduce upto 45%. The recombinant will be az and AZ with 5% frequency. So, father has az with 0.05 % probability.

Thus, the answer is 0.45 from mom and 0.05 from dad.

8 0
3 years ago
Why are the roles in different ecosystems the same but the species that fill them often different?
bearhunter [10]

Answer:

The ecosystems are different

Explanation:

Every ecosystem needs most of the types, such as producers and herbivours, but different animals need different climates, such as cacti need deserts, yet fish need water, they can't( Or shouldn't ) Be in the same ecosystem due to thier needs.

7 0
3 years ago
What happens last after a water soluable hormone approaches it’s target cell
yuradex [85]

Answer:

After the water soluble hormone approaches its target, the last thing that happens in change in cell activity and the hormones send a signal/message to the original hormone.

Explanation:

Water soluble hormones easily attach themselves to the cell. These water soluble hormones are made up of amino acid. Amino acid are basically proteins which are easily soluble in water.

These water soluble hormones cannot enter the cell membrane of the cell because they are made up of fat cells.

7 0
3 years ago
Other questions:
  • What type of frog has translucent skin
    14·2 answers
  • What type of severe weather would most likely decrease biodiversity by destroying sea turtle nests and hatchlings?
    10·2 answers
  • Which of these substances is matched with its correct organic group?
    13·1 answer
  • Which planet has a very dense atmosphere primarily composed of carbon dioxide?
    6·2 answers
  • A population of lizards lives in a rocky area next to a desert. Some lizards are light colored and blend into the sand. Others a
    15·1 answer
  • Rachel Carson was one of the first ecologists to warn against the widespread use
    6·1 answer
  • Which shows the levels of organizational hierarchy listed from least complex to most complex?
    9·1 answer
  • Sound waves travel fastest through what type of material?
    6·2 answers
  • Which of the following describes an effect of particulate matter on health?
    14·1 answer
  • WILL GIVE BRAINLIEST
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!