1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kogti [31]
4 years ago
15

In geography what are the three most important elements of weather​

Geography
2 answers:
Sidana [21]4 years ago
4 0

Answer:

There are six main components, or parts, of weather. They are temperature, atmospheric pressure, wind, humidity, precipitation, and cloudiness.

Explanation:

There are six main components, or parts, ofweather. They are temperature, atmospheric pressure, wind, humidity, precipitation, and cloudiness.

xz_007 [3.2K]4 years ago
3 0
<h2>Answer:</h2>

The three major element of the weather includes temperature, humidity, and pressure.

<h2>Explanation:</h2>

These three components are inter-related to each other. The temperature of the earth depends on the sun rays reaching the earth. When the temperature of the earth increases, the water starts evaporating and the humidity of the air increases which gives rise to the rain or storm.

When the temperature of the earth also influences the pressure pertaining in the surface. Depending on the pressure, the movement of the air takes place and it in changes the climate.

You might be interested in
Latifundios are more likely than ejidos to _____.
Yuliya22 [10]
The answer SHOULD be D, if I'm wrong, I really am sorry.
6 0
3 years ago
Read 2 more answers
What causes molecules to stick together in liquid water
UkoKoshka [18]
When molecules stick together in liquid water it is because the atoms are beginning to slw down and stop so then the moleclues start to stick together in the liquid water causing the moleclues to create a sticky texture.
5 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
What do you m?<br>ean by u shape valley​
Korolek [52]

Answer:

Definition: U-shaped valleys form through glacial erosion. Glaciation develops in established v-shaped river valleys where the ice erodes the surrounding rocks to create a “U” shaped valley with a flat bottom and steep sides. Glacier movement is driven by gravity

5 0
3 years ago
What is the answer? Please
andrezito [222]

Answer:

false

Explanation:

8 0
3 years ago
Other questions:
  • 1. What type of shoreline feature is Drakes Estero (located near the center of the map)? Limant our spit 2. Point Reyes, located
    14·1 answer
  • Describe how a volcano is formed at a Continental Rift. Be sure to include, in your description, what is occurring at the plate
    6·1 answer
  • Tropical weather, such as hurricanes, usually moves along in the direction of which set of winds?
    13·2 answers
  • The part of a line between two points on the line
    6·1 answer
  • Where would you find the largest difference in shallow and deep ocean temperatures?
    8·1 answer
  • This country/continent is located in the Pacific Ocean. New Zealand lies southeast of it.
    10·1 answer
  • Most people of West and Central Africa make a living in which area
    14·1 answer
  • Which line of lattitude runs near Pikes Peek?
    13·1 answer
  • How did volcanic activity lead to the formation of oceans?
    13·1 answer
  • What type of government has the most Control over its citizens
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!