1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ikadub [295]
3 years ago
10

Which sense organ is responsible for movement?

Biology
2 answers:
Nutka1998 [239]3 years ago
8 0

Answer:

Nervous system is the sense organ which is responsible for movement of organisms.

Explanation:

Nervous system comprise of brain and spinal cord which is responsible for the movement of organisms according to the environment. When the organism feels any change which is harmful for the organisms so the nervous system send message to organs to start movement in order to get away from the stimulus.

marin [14]3 years ago
5 0
I think it is the nervous system
You might be interested in
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Summary about DNA , Genes , Traits , Chromosomes. (Explain & let me know about all 4 words. Summarize all these words.) Writ
lisabon 2012 [21]

Answer:

Genes are segments of DNA that contain the code for a specific protein that functions in one or more types of cells in the body. Chromosomes are structures within cells that contain a person's genes. Genes are contained in chromosomes, which are in the cell nucleus. And a trait is a gene-determined characteristic.

8 0
3 years ago
How does a muti-celluar organisms organise
love history [14]

Answer:

Multicellular organisms carry out their life processes through division of labor.

Explanation:

They have specialized cells that do specific jobs. ... Multicellular organisms, depending on their complexity, may be organized from cells to tissues, organs, and organ systems.

3 0
3 years ago
Classify the reaction as unimolecular, bimolecular, or termolecular.
Nostrana [21]
Where's the reaction?
7 0
4 years ago
Read 2 more answers
I think its density...or mass. Can someone check this?
saul85 [17]
That would be mass.
Hope it helps!
3 0
3 years ago
Other questions:
  • Which glands produces hormones that help to regulate body metabolism?
    10·1 answer
  • What is the main difference between aerobic respiration and anaerobic respiration?
    8·1 answer
  • Which ecological unit exists as an interdependent system made up of the physical environment and a living community functioning
    13·1 answer
  • What three units make up a nucleotide?
    15·1 answer
  • Select all that apply.
    8·1 answer
  • What happens to certain nutrient molecules after they pass into muscle cells?
    5·1 answer
  • The students used a microscope to study cells in a
    12·1 answer
  • If you were looking through a microscope at cells, how would you determine if they are plant or animal cells?
    12·2 answers
  • What characteristics do plants and animals have that increase their chances of reproduction?
    14·1 answer
  • Can some one help me :(.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!