1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yan [13]
2 years ago
7

Can anyone answer all of these. Thank You!

Biology
1 answer:
andrey2020 [161]2 years ago
8 0

UM- LFJKAHFAJF SIS WANTS US TO ANSWER ALL OF THEM SKSJSJJS

You might be interested in
Why is it said that there are many species that have yet to be discovered?
Dima020 [189]
Because us humans haven’t explored every inch of the world yet, especially in the deepest parts of the ocean
7 0
3 years ago
Read 2 more answers
how the niche of trees in a temperate rainforest and the Predict niche of squirrels in the same rainforest interact.
maria [59]
Well the niche of a squirrel mostly depends on the niche of a temperate rainforest.The trees need water and sunlight to make a nut.Then the squirrel finds the nut and stores it for the winter
8 0
3 years ago
Which statement describes the motion of the water molecules in this situation? The water molecules move by active transport into
Neporo4naja [7]

The water molecules move by osmosis into the cell from high water concentration to low water concentration.

5 0
3 years ago
Read 2 more answers
When egg white is heated, it hardens and is opaque. This cooking process cannot be reversed, but hard-boiled egg white can be di
marshall27 [118]

Answer:

Generally proteins are denatured at high temperature.Therefore when  the egg is hard boiled they are denatured since eggs are protein,  the 3-dimensional  structure of protein is lost, and it is replaces with tangled meshwork of polypeptide chains .This is because the  orderly arrangements of  disulphide bonds in proteins  are disrupted , which  results in the formation of inter chains bonds among   disulphide bonds, making the protein molecules to link together.This explains the reason for the 3-D structure disruption  and formation of  a macro molecule.

However,   the  addition of reducing agent ,  breaks the covalent disulphide bonds.   While detergent breaks the interchain bonds among the disulphide bonds.  (The noncovalent bonds),These combined effects untangled the  mesh networks of polypeptides formed, and reduces the hardened nature,

Explanation:

5 0
2 years ago
Please help this is due soon ​
Bogdan [553]

Explanation:

The large fish will most likely eat most of the white fish, and there will only be gray fish left. Since the large fish can't see the gray fish well, they catch some but quickly starve because of the lack of white fish. In the end, only gray fish are left.

5 0
2 years ago
Other questions:
  • Look at the data tables below. Which would most likely produce a nonlinear graph? 
    8·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • In which structure would both mitosis and differentiation of an embryo occur?
    15·2 answers
  • A scientist studied the effect of several new drugs (antibiotics x, y and z) to kill anthrax bacteria growing on petri plates wi
    8·1 answer
  • What is the solution of log2 (3x - 7) = 3?
    13·2 answers
  • You have 3 turtles, each with a mutation that causes them to have a strange polka dotted pattern on their shells. Assume all 3 m
    12·1 answer
  • The process by which the number of chromosomes is reduced by half is sex cells is called what
    13·1 answer
  • DNA is always present in lysosomes. a. TRUE b. FALSE​
    7·1 answer
  • What enzyme is involved in the oxidative caboxylation​
    11·1 answer
  • What are Krebs cycle inputs and outputs?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!