1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anastaziya [24]
3 years ago
12

jenny measures the outside temperature as 16 degrees celcius,61 degrees Fahrenheit. she observes precipitation falling from the

clouds in a solid form.what type of precipitation is jenny most likely observing. A)hail B)rain C)sleet D)snow
Biology
2 answers:
aleksley [76]3 years ago
7 0
Rain. Since it is 16 degrees C it is almost 100% sure to be rain. Too warm for sleet, which is possible around, you can guess, 0 C or 32 F (sleet can be formed when surface T is around 5 C, this may variate.
natima [27]3 years ago
6 0
Jenny is most likely seeing sleet dued to the fact it must be 32 degrees Fahrenheit to freeze and turn into a solid snow/ ice.
You might be interested in
A scientist observes some cells under a compound microscope and needs to determine if they are bacteria or yeast. Aside from siz
MAXImum [283]

Answer:

chitin and murein

Explanation:

The chemical compounds that distinguish bacteria cell from yeast cell are  

chitin and murein

Chitin is a polysaccharide present in the exoskeleton of fungi made up of chains of modified glucose known as N-acetylglucosamine. N-acetylglucosamine is derived from glucose

While murein is a mesh like structure made up of sugar and amino acids. Murein forms a layer outside the plasma membrane of bacterial cell.  

8 0
4 years ago
Read 2 more answers
Which sound would most likely have the lowest pitch?
Mandarinka [93]
A chriping bird i would say.
6 0
3 years ago
All engineers...
wariber [46]

All engineers solve problems related to any field. so the answer is option A.


Hope it helps!!!

4 0
3 years ago
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
Which best describes plant classification?
timurjin [86]
Angiosperms are grouped into monocots and dicots
8 0
3 years ago
Read 2 more answers
Other questions:
  • Turtles are higher on the blank than insects?
    7·2 answers
  • Help!!! Someone Can someone please help me with this virtual lab this has to be done by Monday 10•16•17 anything helps please
    13·1 answer
  • Which of the following lists structures from smallest to largest?
    12·1 answer
  • How is the shape of a neuron suited to its purpose?
    13·1 answer
  • In eukaryotes, extranuclear inheritance occurs when genetic information is transmitted by mechanisms other than through nuclear
    14·1 answer
  • Help me with this picture please
    6·2 answers
  • Does a prokaryote cell have vacuoles
    13·1 answer
  • Q33. Explain how the poison caused Jared’s symptoms (e.g., muscle weakness).
    13·1 answer
  • Bacteria in the Shigella genus cause the disease shigellosis. The symptoms of shigellosis include diarrhea, fever, and intestina
    12·1 answer
  • How do C4 plants ensure photosynthetic efficiency?​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!