1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
atroni [7]
3 years ago
5

How does the body benefit from the change of blood pressure during exercise?

Biology
1 answer:
Alika [10]3 years ago
7 0
It spreads blood and oxygen throughout your body.

You might be interested in
The uppermost horizon, horizon O, is composed mostly of _____, while the lower horizon, horizon C, is composed mostly of _______
vlabodo [156]
<span>Potential energy because it has the potential to move.</span>
8 0
3 years ago
Read 2 more answers
What might the shape of the skull and the supraorbital height tell us about each species?
Sladkaya [172]

Answer: The shape of the skull and the supraorbital height tell us the following about each species-

  • It can tell us about the intelligence of species and what all senses they were dependent upon for their survival
  • Most of the species possess similar skulls as mostly their structures are  oval shaped, sloped or round shaped.
  • Species have different food habits that is determined by the teeth, which vary from long and dull to short and dull.
  • Variation in teeth and face shapes could also be due to different geological locations.
  • In particular, the foramen magnum be located where the spine connects can be attributed to how the species gathered food through hunting and what kind of food they sought after.
  • Overall, the shape and the supraorbital height of each skull informs us the advantages and disadvantages each species had in its ecosystem.
  • It also tells what probable causes of death would be when the species died.
8 0
2 years ago
Read 2 more answers
What nucleotide bonds with cytosine?
alexandr1967 [171]

GUANINE

Adenine always bonds with thymine, and cytosine always bonds with guanine.

hope it helps...!!!

7 0
2 years ago
Which one of the following activities seems to be innate for dogs?
il63 [147K]
Innate activities are activities that are intrinsic, which means activities that are part of our genetic and physiological being. Examples: desire to feel good, to feel warm, to have no pain,...
For dogs the innate activities are to run, to touch , to play, to go outdoors,...
According to these explanation the following activities seems to be innate for dogs:
B. Submitting to its owner - the dog has connection and life with his owner
3 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • Which of the following is not a major component of soil
    5·2 answers
  • Which characteristic is used to categorize the different kinds of animal like protists
    10·2 answers
  • Why do some investigations require a control
    6·2 answers
  • Which process would release energy from gold, fission or fusion? from carbon?
    5·1 answer
  • During photosynthesis, light energy is converted to the energy in chemical bonds. What also happens according to the predictions
    6·2 answers
  • What hormone does the parathyroid gland produce?
    8·1 answer
  • Please help me!<br> -temperature<br> -ocean<br> -climate
    6·2 answers
  • This external structure is often a feature of bacterial pathogens; it aids in allowing the bacterium to counteract the body's im
    6·1 answer
  • Help? It’s ok if not but I really need it &lt;333
    15·1 answer
  • PLEASE HELP!!
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!