1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
igor_vitrenko [27]
2 years ago
8

Through what process do producers make their own food?

Biology
1 answer:
ki77a [65]2 years ago
6 0

Answer:

b. Photosynthesis

Explanation:

Photosynthesis is the process by which producers make their own food from raw materials: carbon dioxide and water in the presence of sunlight.

You might be interested in
Which statement best reflects what is known about the theory of plate tectonics? Earth's lithosphere is composed of about five l
love history [14]

Answer:

Option (4)

Explanation:

The earth is comprised of numerous lithospheric plates. This lithosphere is comprised of dozens of major plates and a few minor plates. These plates are constantly in motion over the less dense asthenosphere layer where the rocks tend to flow during deformation. This plate motion takes place due to the creation of convection current in the mantle region as a result of which the plates move under the influence of uprising magma. These currents are formed because of the heat supplied from the core of the earth.

Some of the major plates are Indo-Australian plate, North American Plate, South American plate and the Pacific plate.

Some of the minor plates include the Cocos plate, Nazca plate, and Caribbean plate.

Thus, the correct answer is option (4).

6 0
3 years ago
Read 2 more answers
PLEASE HELP. WILL GIVE BRAINLIEST. What role do decomposers play in an ecosystem? Be sure to refer to the biogeochemical cycles.
iren2701 [21]
Decomposers and scavengers break down dead plants and animals. They also break down the waste (poop) of other organisms. Decomposers are very important for any ecosystem. If they weren't in the ecosystem, the plants would not get essential nutrients, and dead matter and waste would pile up.
7 0
3 years ago
Glycoproteins are molecules that are partially simple _______ and partially _________. fig 4.27
serg [7]
The correct answers are "sugar" and "amino acids." We can find this answer within the name itself. The prefix "glyco-" relates to producing sugar (think glucose and glycogen, which are both forms of sugar), and the suffix "proteins" is exactly that: proteins (which are made up of amino acids). So, when we say glycoprotein, we can think "sugar-protein," which gives us our answer.
7 0
3 years ago
The process of scientific inquiry can be best used to answer which question? Why do diseases exist? What should I do? Why do bad
dmitriy555 [2]
I don't know about the other ones but the sky is blue because molecules move from the sun than the red from the sun. The blue has separated from the sun.
7 0
3 years ago
Name 3 things that organisms need from their environment​
Stella [2.4K]
<h2>Depending on the organism, these needs may include: air, water, nutrients, food, light, shelter, space, certain temperatures, etc. Plants need soil, nutrients, sunlight, water, space, air and appropriate temperatures to survive. Animals need food, water, shelter, oxygen, space and appropriate.  You can write:  Organisms need air, water and food from their environment.  I hope this helps you!  </h2>
7 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which organisms are prokaryotes?
    10·2 answers
  • A cell has no membrane proteins at all. Which substance will diffuse across the membrane fastest? Na+ glucose H2O
    6·1 answer
  • What substance do you find the plant's male gametes?
    15·1 answer
  • How would signaling be affected if a mutation caused a g protein to replace gdp with gtp on its own without needing to be activa
    15·1 answer
  • Are mouse cells eukaryotic or prokaryotic?
    9·2 answers
  • Which of the following is a true statement?
    15·1 answer
  • The European buckthorn was introduced to North America as an ornamental plant. However, this plant is now a major threat to many
    7·1 answer
  • Does the temperature continuously increase as energy is added?
    9·1 answer
  • A man who has a X-linked (sex-linked) allele will pass it on to
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!