1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
drek231 [11]
4 years ago
15

Different between the basic structural and functional units of the Kidney and the lungs Based on the following points:- A)Name ,

B) Structure , C) Function
Biology
1 answer:
kaheart [24]4 years ago
5 0

The functional unit of the kidney is nephron. Kidney comprises two kinds of nephrons, each situated in distinct sections of the renal cortex, that is, juxtamedullary nephrons and cortical nephrons. A nephron constitutes of a renal tubule, renal corpuscle, and the associated network of capillaries. The nephron is accountable for eradicating waste from the body.  

The functional unit of lungs is alveoli. They resemble a cluster of grapes, they are thin and possess moist walls. They are a single layer of cells enveloped by a layer of capillaries. The main function of the lungs is respiration. The alveoli help one to breathe, by conducting the process of gas exchange.  


You might be interested in
Which process causes Earth to lose thermal energy to space?
geniusboy [140]
I believe it would be Heat Radiation
8 0
3 years ago
Read 2 more answers
5. What happens to the blood flow in the cardiac cycle?
joja [24]

Answer:

the answer is C

Explanation:

6 0
3 years ago
tWhich organs are part of the excretory system? a)stomach, esophagus b)kidney, bladder c)large intestine, small intestine d)gizz
Ronch [10]

Answer/Explanation:

b) kidney and bladder

Kidneys are the main organ in the excretory system and the bladder stores the urine in the body. These are two of the organs that make up the excretory system.  

4 0
3 years ago
Need the answer quick please thanks
ohaa [14]

Answer:

id k im not in high school

Explanation:

4 0
3 years ago
A group of students wants to study the structures of animals in the desert. One question they should ask is-
Brrunno [24]

From studies and research, I believe the proper question would be:

"How do the animals satisfy their need for water?" or "How long do the animals live?"

Explanation 1:

When studying the desert, asking "Can you buy the animals in pet stores?" is not going to help you find information about the desert because it is not a question to get information about the desert, only information if you just buy it at your local pet shop.

Explanation 2:

Asking "How many offspring do the animals have?" does help us learn about animals, but we are trying to find information on the structure of the desert in which the animals live in. We are not looking for how many children the animals will have because it doesn't fully relate to the question we would be asking.

Side Note: Offsprings mean children.

           <em>Hope this helps!</em>

<em>       ~Hocus Pocus</em>

5 0
3 years ago
Other questions:
  • 01.03]Which of the following statements about science is true? Science is built on opinions and assumptions. Science is tested b
    12·2 answers
  • Radioactive Decay of Carbon 14
    13·1 answer
  • Please help I’m stuck.
    12·1 answer
  • The laboratory findings of an obese hypertensive adolescent reveal hyperinsulinemia and dyslipidemia. which condition is the ado
    13·1 answer
  • In which direction or directions do sea floors spread? A. North and south parallel to mid ocean are Ridges B. And or towards the
    9·1 answer
  • What happens to an enzyme’s structure as it exceeds the typical human body temperature?
    8·1 answer
  • Which statement is true?
    15·2 answers
  • Skin does not have to be kept clean and moist to look and feel good. true false
    8·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Cuales son 3 biomoleculas organicas que tenga el oxigeno?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!