A) Deoxyribose + phosphate group + thymine
At a glance this one's confusing, I agree.
Genetic engineering has made it easier for forensic scientists to differentiate human DNA beyond simple blood sampling. This inevitable led to release of innocent accused prisoners.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
a
Explanation:
i am right made a 100 good
Around 25 ounces, but it is based on demand. Many women have different amounts.