1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Troyanec [42]
3 years ago
14

Activity: Create your own cell membrane. In your model, be sure to include the following: parts/structures function/use layers t

ypes of proteins receptor molecules molecules that can pass through it other characteristics

Biology
1 answer:
Gwar [14]3 years ago
4 0

Explanation:

Lipids are composed of fatty acids which form the hydrobic tail and glycerol which forms the hydrophilic head; glycerol is a 3-Carbon alcohol which id water soluble, while the fatty acid tail is a long chain hydrocarbon (hydrogens attached to a carbon backbone) with up to 36 carbons.

Their polarity or arrangement can give these non-polar macromolecules hydrophilic and hydrophobic properties. Via diffusion, small water molecules can move across the phospholipid bilayer acts as a semi-permeable membrane into the extracellular fluid or the cytoplasm which are both hydrophilic and contain large concentrations of polar water molecules or other water-soluble compounds. The hydrophilic heads of the bilayer are attracted to water while their water-repellent hydrophobic tails face towards each other- allowing molecules of water to diffuse across the membrane along the concentration gradient.

Transmembrane proteins are embedded within the membrane from the extracellular fluid to the cytoplasm, and are sometimes attached to glycoproteins (proteins attached to carbohydrates) which function as cell surface markers or at as doorways for other molecules to pass through. Cholesterol, which is comparatively rigid, anchors other molecules attached to the membrane, maintain membrane stability or structural integrity and aid in separating some lipids, helping with membrane fluidity at low environmental temperatures.

Remember, essential features:

  • lipid bilayer
  • cholesterols
  • proteins (cell markers and  doorways)

Learn more about membrane components at brainly.com/question/1971706

Learn more about plasma membrane transport at brainly.com/question/11410881

#LearnWithBrainly

You might be interested in
Somatostatin hücrelerden hangisinden salgılanır
ivolga24 [154]
Somatostatin, pankreasın Langerhans adacıklarının D-hücrelerinden ve hipotalamustan salıverilen bir peptit hormondur; hipotalamustan salıverilen büyüme hormonu salıverilişini inhibe eden faktör olarak da bilinir.
8 0
3 years ago
Read 2 more answers
What change would most improve the usefulness of the graph
masha68 [24]
<span>Replace the concentration descriptions with actual values.</span>
3 0
3 years ago
Read 2 more answers
Is the brain made up of Neurons itself?<br><br> Please don't answer unless you know the answer
Anuta_ua [19.1K]

Answer:

Yup it is made of neutrons itself composed of both neutrons and glial cells

5 0
3 years ago
A single high tide and low tide daily is called ?
fiasKO [112]
A "Tidal Cycle" is what this is called...
3 0
4 years ago
A DNA sequence encoding a five-amino acid polypeptide is given below:
Blizzard [7]

Answer:

Explanation:

The sequence recording the five amino acid is 5' CTA-ATC-AGA-CCG-TAC-CAT 3'

The template strand is the strand from which the mRNA is transcribed

ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT

The coding stranger has the same sequence as the mRNA except the replacement of T with U in the mRNA

TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA

b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'

c. N terminus Met-Val-Arg-Ser-Asp C terminus

d. The shine delgarno region is GGAGGA

e. This region functions as the mRNA binding site to the small subunit of the ribosome in the process of translation.

3 0
4 years ago
Other questions:
  • Let’s pretend we are studying camels in the Namib desert. There were two possible genotypes for the shape of a camel foot.
    6·1 answer
  • What effect does a quadrupling of the mass have upon the acceleration of the object ?
    6·2 answers
  • How does the mantle interact with the crust at a subduction zone?
    7·2 answers
  • The littoral is a zone identified in lakes and ponds and is the coldest because it is shallow and lacks nutrients to support lif
    15·2 answers
  • Is Aragonite a natural resource
    9·2 answers
  • After crossing purebred red (dominant) and purebred white (recessive) flowers, pink flowers appeared. Using symbols, show the cr
    7·2 answers
  • How do viruses enter your cell and use your cell?
    10·2 answers
  • What is an analogy for active transport and passive transport?
    12·1 answer
  • IN YOUR OWN WORDS, what is the definition for Zygote?
    10·2 answers
  • Two pieces of foil being heated by a candle. Warm atoms are red, and cool atoms are blue. The top foil has a small number of war
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!