1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MakcuM [25]
3 years ago
10

Food web stability is most dependent on _____.

Biology
1 answer:
mash [69]3 years ago
6 0

Answer:

sun water nitrogin? oxygen and carbon dioxide.

Explanation:

i think thats it but i am not entirely sure.

You might be interested in
What causes sublimations to happen <br><br>​
Andreas93 [3]

Answer:

its caused by the absorption of heat. hope this helps:)

5 0
2 years ago
Read 2 more answers
Contrast mitosis and cytokinesis
lyudmila [28]

Answer:

why

Explanation:

8 0
2 years ago
.tcji No thx I'm fine again
dsp73
Please help me with my question
7 0
1 year ago
Read 2 more answers
Deficiencies in __________ have been linked to anxiety, mood disorders, eating disorders, and insomnia. question 1 options: nore
IrinaK [193]
~Hello There!~

The answer is serotonin.

Hope This Helps You!
Good Luck :)
Have A Great Day ^_^

- Hannah ❤
6 0
3 years ago
If the bicuspid (mitral) valve is not fully closing, does pulmonary circulation increase, decrease, or not change?
elena-14-01-66 [18.8K]

Answer: Decrease

It will decrees because required volume of blood will not be   emptied into the pulmonary circulation  to reach the lung for oxygenation. Rather blood flows back into the  Right  atrium ,(regurgitation,) through the these valves   during ventricular contraction ( systole)of the Right Ventricle instead to the pulmonary circulation which  reduces blood flow leading  to volume overload  in  the heart. Eventually this  affects systemic circulation,

Explanation:

8 0
3 years ago
Other questions:
  • An atom consist of an atomic nucleus composed of positvely charged
    14·1 answer
  • Three ways species vary
    9·1 answer
  • What are the seed leaves that provide energy for young seedlings of angiosperms called?
    8·1 answer
  • Tell me one specific instance where science was or is being used to make decisions.
    6·1 answer
  • A scientist makes a claim that two hominid species have a common evolutionary ancestor. Which of the following must happen to en
    15·2 answers
  • A young child develops type 1A diabetes. The parents ask, They tell us this is genetic. Does that mean our other children will g
    13·1 answer
  • What can rapidly pass directly through the phospholipids of the plasma membrane
    6·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • According to the Daily Chill, krill count has dropped to an all-time low this season! Penguinsrely on krill to survive in the An
    13·1 answer
  • Anyone wanna help me ???????
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!