1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Troyanec [42]
3 years ago
12

Dahlgren and Whitehead model

Health
2 answers:
Lelu [443]3 years ago
4 0

Answer: The model seeks to explain how social inequalities in health are the result of interactions between different levels of causal conditions, ranging from the individual to the communities.

Explanation:

The Dahlgren and Whitehead model are represented by a series of capable, where each of them explains how the process occurs.

1- The first is called the individual level. This level highlights age, sex, and hereditary factors such as those that influence at the time a person develops a disease. These are not modifiable, they are the person's own.

2 - The second level contemplates the factors related to the lifestyle that a person leads, that is, their habits and behaviors related to health exert a great influence on how their physical and mental state is.

3- The social and community influences are located on the third level. Community support exerts some influence on what is health.

4 - The fourth level contemplates what are the conditions of life and work, where factors related to access to food, jobs, and services such as education, drinking water, and housing, influence the well-being of people.

5- The fifth and last level highlights the general economic, environmental and cultural conditions of society.

Illusion [34]3 years ago
3 0

Answer:

poopybutt

Explanation:

You might be interested in
Sam munches on some almonds. Identify the food group to which almonds belong. A. fruits B. milk products C. meat and beans D. ve
Arturiano [62]
I think it's D. vegetables
3 0
3 years ago
Read 2 more answers
Muscle cramps are often associated with A. a lack of vitamin E. B. too much sodium. C. hyponatremia. D. dehydration.
nignag [31]
Muscle cramps are often associated with a lack of vitamin B - lacking this vitamin will often be correlated to this occurence; if not directly cause it. This is also the reason why bodybuilders sometimes find themselves cramped up during competitions because they don't take enough vitamins before the competition. 
7 0
4 years ago
Read 2 more answers
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
General functions of the six classes of nutrients include all of the following except
arlik [135]
General functions of the six classes of nutrients include all of the following except adding flavor to food.

6 0
3 years ago
Read 2 more answers
Describe (in your own words) the four distinct phases that characterize the progression of alcoholism.
elixir [45]

Answer:

pre-alcoholic, early alcholic, middle alcoholic, and late alcoholic.

Explanation:

8 0
3 years ago
Other questions:
  • What are the health risks of a deer licking you?
    11·1 answer
  • In human development, an embryo is most sensitive to chemicals, radiation, or pathogens at first trimester, because this is when
    13·1 answer
  • What are some treatments for bruised nails
    6·2 answers
  • Which of the following contains cholesterol <br><br>A. a peer<br>B. corn <br>C. cereal <br>D. an egg
    10·2 answers
  • Stretching is _____. is considered exercise some of the time, improves the health of your muscles, is mostly performed in the mi
    13·1 answer
  • What are some benefits of Tennis ? Use in your own words.​
    10·2 answers
  • What is a benefit of group dating?
    12·1 answer
  • Brief History of Sanofi?
    9·1 answer
  • Take all my points. I don't even care anymore. Just so you know, I'm broken and there's really no point in fixing me. I love you
    11·1 answer
  • Why would Chris most likely conclude that he should seek help?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!