1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GenaCL600 [577]
2 years ago
9

Where do producers belong in a food chain?

Biology
1 answer:
MaRussiya [10]2 years ago
7 0
The beginning or the first trophic level.
You might be interested in
Explain the stages of tissue repair and fill in the blanks.
svp [43]

Answer:

a. Following an injury that breaks the surface of the skin. blood vessels dilate as a result of histamine release from mast cells and other damaged cells.

b. The blood forms a clot and upon drying, a scab forms a barriers between the body and the environment, while phagocytes work to clear the underlying debris from the wound site.

c. Blood vessels begin to re-grow into the wound while fibroblasts begin process of replacing the blood clot with Collagen

d. The remodeling phase then occurs as fibrosis and regeneration of tissues may continue for prolonged period of time.

Explanation:

Hello. Although you did not have all the answer options for the blanks presented in the sentences above, it is possible to conclude that the words in bold are the most appropriate to fill these spaces.

That's because when we cut ourselves, the blood vessels on the surface of our skin rapidly dilate, allowing a flow of blood to be observed. This dilation is accomplished by the release of histamine, which is released by mast cells, which are glands that regulate the immune response. At this point, it is important that any impuzera or microorganism, close to the wound site, is removed and this site undergoes cleaning. This is done by phagocytes, which are intended to prevent the cut from becoming the entrance to a bacterial infection.

Then the blood vessels begin to move and grow again across the wound, with the aim of covering this opening. In this comment, fibroblasts begin to apply collagen and replace the blood clot formed to prevent blood loss. Collagen will be responsible for maintaining the skin and tissues that will be rebuilt in the remodeling phase.

3 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Which picture should I use for supporting that my hypothesis was not supported? And please make a good explanation of the pictur
yanalaym [24]

Answer:

You should probably use the third picture to support that your hypothesis was incorrect.

Explanation:

I do not know what your project was, but it seems as though you were able to gather that the state of matter is liquid throughout the experiemnt using the last picture. If your hypothesis was that the state of matter would change, then the third picture would show that this is wrong, as it remains in a liquid state.

4 0
3 years ago
3. Which statement concerning an ecosystem is correct?
brilliants [131]

Answer:

C) It involves interactions between biotic and

abiotic factors.

Explanation:

Ecosystems need energy imput, need both consumers and producers, and can exist on land, lakes, rivers and oceans.

6 0
2 years ago
How come one type of matter can be converted to a totally different one?
wariber [46]

Answer:

Explanation:

En física, la materia es todo aquello que se extiende en cierta región del espacio-tiempo, que posee energía y está sujeto a cambios en el tiempo y a interacciones con aparatos de medida. Se considera que es lo que forma la parte sensible de los objetos perceptibles o detectables por medios físicos.

Etimológicamente, proviene del latín materia, que significa «sustancia de la que están hechas las cosas» y que también alude a la «madera dura del interior de un árbol»;1​ la palabra está relacionada con māter («origen, fuente, madre»)2​ y se corresponde con el griego hyle3​ (de hylos: «bosque, madera, leña, material»)4​5​ que es un concepto aristotélico de la teoría filosófica del hilemorfismo.6​

El uso moderno del término va más allá de la noción clásica de sustancia, y los físicos denominan materia a cualquier entidad cuya presencia en una cierta región del espacio-tiempo conlleva que el tensor energía-impulso para dicha región es diferente de cero.

8 0
3 years ago
Other questions:
  • Which component of the ready-to-use-therapeutic food (rutf) that dr. manary uses provides essential amino acids?
    12·1 answer
  • Monoecious plants Dioecious plants Angiosperms Gymnosperms A. has megasporangiate and microsporangiate flowers on the same plant
    14·2 answers
  • How has technology changed the way people communicate?
    12·2 answers
  • True or False: All living organisms have cell membranes.
    12·1 answer
  • Describe the treatment goals for dialysis.
    6·2 answers
  • Anemia is caused by a defective gene resulting in abnormal hemoglobin: a. Hemorrhagic anemia b. Aplastic Anemia c. Pernicous Ane
    11·1 answer
  • To produce starch, glucose molecules bond together through
    7·2 answers
  • Ok I have three questions I really need help with!!
    11·1 answer
  • Karl Marx promoted Which economic idea?
    5·1 answer
  • I need help in biology please help
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!