1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
True [87]
4 years ago
13

Briefly describe the roles of the endocrine and nervous system. Explain how they work together to maintain homeostasis in a huma

n body.
Biology
1 answer:
lora16 [44]4 years ago
7 0
Any interruption to the flow of blood<span> may bring brain damage or death. The </span>nervous system maintains homeostasis<span> by controlling and regulating the other parts of the </span>body<span>. A deviation from a normal set point acts as a stimulus to a receptor, which sends nerve impulses to a regulating center in the brain.</span>
You might be interested in
When you’re around children, it’s important that your body language conveys
pickupchik [31]
The same message as your words
4 0
4 years ago
The movement of tectonic plates buries a rock deep inside Earth. Intense heat and pressure change the mineral composition of the
Tems11 [23]

Answer:

Rock B has a fine grainy texture and small crystals

Explanation:

1. still hasn't turned into sedimentary rock, or metamorphic. Its most likely gonna be igneous  and Igneous rocks have grainy texture and small crystals since its still developing

8 0
3 years ago
The amount of atmospheric
Viktor [21]

Answer:

The amount of atmospheric oxygen is more than the amount of dissolved atmospheric oxygen in water.

Explanation:

The oxygen which is present in the atmosphere is much higher than the oxygen which is present inside the water. About 21 percent of oxygen is present in the atmosphere while only 1 percent of atmospheric oxygen is dissolved in the water. Oxygen is higher in atmosphere because this oxygen is used during respiration of organisms. If concentration of dissolved oxygen is very high, the marine animals die.

7 0
3 years ago
Studying the folding patterns of protein molecules can help microbiologists better understand cellular processes as well as some
vivado [14]
The statement that best describes the work of these researchers is "As a result, the researchers have been able to achieve protein-folding simulations that are far better than those other computing methods have done." I hope my answer has come to your help. God bless and have a nice day ahead!
5 0
3 years ago
Why to introduced species thrive and multiply so easily in their new habitats
PolarNik [594]
Actually depends on the species. Take snakes for example. They quickly thrived here in america because they had similar environements over in europe. The warm climate here in florida is perfect for them. They like the heat of the sun the dense foliage and many other good qualities here. Also their are other places that are good as long as they are hot have water and prey and a nice hole they can sleep in they can survive making them very adaptable. 
7 0
3 years ago
Other questions:
  • which protein would you expect to find closer to the wells where the sample was loaded: a protein with a molecular weight of 10,
    12·1 answer
  • Sequence the steps involved in the making of the cast of a shell
    8·1 answer
  • Fill in the blank.
    14·2 answers
  • A wildfire in a forest causes a population of deer to flee to a nearby field. This field is home to a population of rabbits. Whi
    8·2 answers
  • Please answer.....please​
    9·1 answer
  • Viruses have many things in common with living organisms, but they are NOT actually considered living. Why?
    6·2 answers
  • A scientist looks under a microscope and sees two cells in the process of dividing. Which principle of cell theory would this ev
    10·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  •  In multicellular organisms, cells become different from one another in order to carry out particular functions. This is called 
    14·1 answer
  • PLEASE HELP ILL GIVE BRAINLIEST
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!