1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blizzard [7]
3 years ago
7

A dehydration reaction can also be called a (an) _______ reaction since it forms water.

Biology
1 answer:
Oduvanchick [21]3 years ago
6 0

Answer:

The correct answer is - option B. condensation

Explanation:

You might be interested in
All viruses rely on<br> friends<br><br> themselves<br><br> a host<br><br> the weather
satela [25.4K]
All viruses rely on themselves
(please mark brainliest)
7 0
3 years ago
An E OSY T M has both biotic and abotic<br><br><br><br><br> Science
Lorico [155]

Answer:

yes. a ecosystem consist of both biotic and abiotic factor

5 0
3 years ago
A 3 base section of mRNA. The ribosome reads 1 codon at a time; translation of a new protein always begins with _________, or Me
lukranit [14]

Answer:

The start codon is AUG

Explanation:

A three nucleotide sequence (represented with bases) of a DNA or a RNA which translates to a specific amino acid is referred to as codon. To begin the translation into a new protein, the first three nucleotide is always AUG (called the START codon) which is the codon for methionine.

NOTE: AUG is the initial of the bases; Adenine, Uracil and Guanine

7 0
3 years ago
State which type of fat is harmful to human, and what kind of bonds it has. *
Paha777 [63]

Answer:

saturated fats:single bonds

trans fat: one doubled bond

7 0
3 years ago
Read 2 more answers
which substance is a waste that would normally diffuse across the placenta from the embryo to the mother?
Olenka [21]
That waste product would be carbon dioxide.
3 0
3 years ago
Other questions:
  • The islets of __________ are the hormone-producing structures in the pancreas that manufacture insulin and __________.
    15·1 answer
  • An important organelle found in eukaryotic cells produces ribosomal subunits from proteins and ribosomal RNA, also known as rRNA
    5·2 answers
  • The presence of what group differentiates most amino acids from each other?
    6·1 answer
  • Infant respiratory distress syndrome is also called hyaline membrane disease.
    15·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • How can zoning laws be beneficial to a city’s residents? a. They prevent new business development. b. They can prevent new devel
    14·2 answers
  • Put the scientific method in the correct order.
    5·2 answers
  • Cells
    10·1 answer
  • the mississippi river carries tons of tiny rock fragments called sediments into the gulf of mexico. what do you think will happe
    8·1 answer
  • Pls help again, brainlist!!!!!!!!!!!!!!!!!
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!