AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
D.
Selective breeding
In selective breeding, the desired genes from one organism are combined with genes of another organism, resulting in a new combination of genes.
<span>The selective breeding is quite voluntary and is not necessarily natural or congenital. It is the act of how people or individuals can choose traits in the gene pool of their choice to produce their desired or goal organism in the process. This trait is influenced in the host of the specific sperm and egg cell which makes up the chromosomes. </span>
Answer:
Explanation:
Aldosterone is a hormone which is produced by the adrenal glands which are present above the kidneys. The role of aldosterone is to regulate the blood pressure. It causes the reabsorption of water and salts into the bloodstream during the kidney filteration process. Hence, maintains the blood volume, restors blood pressure and salt level.
Renin is an enzyme. It facilitates chemical reactions which stimulates the synthesis of angiotension II, it directs the synthesis of aldosterone.
Answer:
The genotypic ratio and phenotypic ratio are different when a monohybrid cross is done because multiple genotypes often result in the same phenotype.
Answer:run to the patient's room when code blue is called
Explanation:
