1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
torisob [31]
3 years ago
11

Please help with questions 5 throught 9

Biology
2 answers:
MissTica3 years ago
5 0
The order is 8 6 9 7 5
Vlada [557]3 years ago
4 0
The correct answers are as follows:
5) Step Number Five
6) Step Number Two
7) Step Number Four
8) Step Number One
9) Step Number Three.

Hope this helps.
You might be interested in
If you were standing at the North Pole, where would Polaris be located
Novay_Z [31]

Answer:  A) At your zenith

Explanation: Because Polaris, The "North Star", Is located alost directly over the Earth's North Pole. FUN FACT: This star was also used by sailors to navigate when maps could not be used

6 0
3 years ago
Lizzie loves to stargaze at night. She has noticed that the moon appears to change shape over the course of the month, and she w
V125BC [204]
Three variables can be used . 
1. Sun 2. Moon 3. Earth
These are suggestions that lizzie can control:
1.<span> Discover how long the Earth takes to orbit the Sun
2. how many hours it takes the Earth to spin around once on its own axis, 3. how long the Moon takes to orbit the Earth</span>
3 0
3 years ago
Read 2 more answers
A child is born with downsyndrome when did the mutation occur
Reil [10]
It occurred during meiosis.
just took the test, hope this helps:)
4 0
3 years ago
Okazaki fragments are _____. the discontinuous segments of the lagging strand non-coding strands of dna located between continuo
Lapatulllka [165]

Okazaki fragments are the discontinuous segments of the lagging strand.

Okazaki fragments are located on the template strand which dictates the newly synthesized DNA away from the direction of the movement of replication fork. It is the building block for DNA synthesis of the lagging strand and on one template strand, the DNA polymerase synthesizes the new DNA in the opposite direction that is away from the replication fork movement.

8 0
3 years ago
What mistake did Freda make in her design process that kept her from completing her project?
kkurt [141]

Answer:

A. She did not account for cost constraints in her solution

Explanation:

7 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Punnett squares dihybrid crosses
    9·1 answer
  • Which structure contains peptidoglycan in bacteria? What is the name of the structure?
    12·2 answers
  • As scientists have developed more productive crop varieties, farmers have switched from growing many traditional varieties to ne
    11·1 answer
  • In an experiment, a student mixed a substrate and an enzyme. Which statement BEST explains the reaction?
    8·2 answers
  • Which two types of structures make up the earthworm's heart?
    15·1 answer
  • If all the genes of E. coli were active at once, what would result?
    6·2 answers
  • Water is an example of a(n) _____.
    13·2 answers
  • On which bone does Zygomatic Process occurs?
    13·2 answers
  • What two things can happen to pyruvic acid? Explain both
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!