1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nika2105 [10]
4 years ago
12

I NEED ANSWERED ASAP PLS

Biology
1 answer:
Fofino [41]4 years ago
6 0

The answer to this statement is

True

You might be interested in
If the us modifies techniques for timber management, it is expected that us forests will _______. a. not be able to meet long te
zubka84 [21]

If the us modifies techniques for timber management, it is expected that us forests will be able to meet long term timber needs

<h3>If the US modifies techniques for timber management?</h3>

Forest management is the rational and environmentally appropriate use of forest resources. Management is an economic activity opposed to deforestation, as there is no total removal of the forest and even after use, the site will maintain its forest structure.

With this information, we can conclude that If the us modifies techniques for timber management, it is expected that us forests will be able to meet long term timber needs.

Learn more about timber management in brainly.com/question/17150866

7 0
2 years ago
Give two reasons that the rat population is not a hardy Weinberg equilibrium
Mumz [18]
1. The population is under selection pressure from predators 
<span>2. Hey now, no population is ever at H-W equilibrium: </span>
<span>mutations happen </span>
<span>immigration and emigration can occur </span>
<span>the population is not huge, which means that genetic drift can happen </span>
<span>mating is not completely random -- a rat is more likely to mate with someone local than with someone living in Paris, France. </span>

<span>b) The small rats will be selected for (assuming there are predators in this ecosystem that are less likely to look in bushes, and further assuming that the small rats do not have reduced fertility by dint of being small) </span>
<span>This is "directional selection" </span>

<span>c) I would expect the "smallness" allele frequency to increase in this population over time, and the "normal size" allele frequency to decrease.</span>
4 0
3 years ago
Read 2 more answers
How can one improve the production of plum?
lora16 [44]

Answer:

Plant more plum trees, and take care of exisisting trees well

6 0
3 years ago
Read 2 more answers
The different forms of a gene for the same characteristic are called _______________________.
OLEGan [10]

Answer:

allele

Explanation:

7 0
3 years ago
Which three structures are found in both prokaryotic
Natalija [7]

Answer:

The structures that are found in both eukaryotic and prokaryotic cell are-

Explanation:

ribosomes, DNA, cytoplasm.

Ribosomes are biomolecular complex, composed of RNA and protein and act as the site for protein synthesis in all the cells of the living organisms.

DNA (deoxyribonucleic acid) is considered.

7 0
3 years ago
Other questions:
  • Melanoma is a skin cancer that occurs in the melanocyte cells of the body. What could be a cause of melanoma? A) vitamin A defic
    10·2 answers
  • Ivan wants to build an electromagnet. What three materials will Ivan need?
    14·1 answer
  • An open wound in which tissue is separated from the body
    13·1 answer
  • The scientific community disagrees about ___.
    7·1 answer
  • The harp seal lives on the polar ice sheets. Which adaptation makes it best suited for this environment?
    8·1 answer
  • 25. If a solution contains more hydronium ions than hydroxide ions, the
    7·1 answer
  • What are hydrophytes, mesophytes and xerophytes.​
    15·2 answers
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • What is the connection between phenotypes and genotypes?
    12·2 answers
  • Please help me I have no more points please help I’m begging you please
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!