1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saveliy_v [14]
3 years ago
7

A student is running a 3-kilometer race. He runs 1 kilometer every 2 minutes. Select the function that describes his distance fr

om the finish line after x minutes.
Mathematics
1 answer:
stepladder [879]3 years ago
5 0
Distance from finish line can be computed by subtracting the amount he has ran from 3. Every minute he runs .5km, and we can use this to create a function to describe this instance.
y = 3- .5x
The distance remaining is equivalent to the minutes multiplied by .5km for each minute subtracted from 3 which is the total distance.

You might be interested in
Find the length of arc ac in terms of pi
aniked [119]
=theta/360°×2pi ×r
theta=180-60=120°
r=24÷2=12

120/360 × 2 × 22/7 × 12=
1/3 × 2 × 22/7 × 12=
176/7=
25.14


3 0
4 years ago
Round each fraction to the nearest half and find the estimate.
erastova [34]

Answer: The result is one half (\frac{1}{2})

Step-by-step explanation:

We have the following expression:

\frac{2}{6}+\frac{1}{6}

Since both fractions have the same denominator, we can just add both numerators and keep the denominator:

\frac{2+1}{6}=\frac{3}{6}

Dividing numerator and denominator by 3:

\frac{\frac{3}{3}}{\frac{6}{3}}=\frac{1}{2} This is the result

3 0
3 years ago
Find the function value.
MArishka [77]
Hey!! here is your answer --


1) tan30° = √3/3

2) cot30° = √3

3) sec30° = (2√3)/3

★ hope you like it ★

---
6 0
4 years ago
Read 2 more answers
What is the answer to -x+6-5x=14-2x
worty [1.4K]

Answer:

ok we start form thedrgvbjm,;.Step-by-step explanation:

6 0
3 years ago
Read 2 more answers
How many different ways can 3 events be ordered?
beks73 [17]

Answer:

6

Step-by-step explanation:

Label them as variables

A, B, and C

Now try and list them

ABC

ACB

BAC

BCA

CAB

CBA

There should be 6

The more mathematical way is using factorials

So you would do 3! which is 3*2*1

This also gives you 6

6 0
3 years ago
Read 2 more answers
Other questions:
  • What is the sum of 56+64 writen as the product of its gcf and another sum
    11·1 answer
  • The difference of a number divided by 7 and 9 is equal to 2. use the variable C what the unknown
    7·1 answer
  • CLOOOOOOOOOOOOOOGEEEEEEERRRRRRRRRRSSSSS
    15·2 answers
  • Hi i need help on letters:
    5·1 answer
  • If the legs of a right triangle are given by x2 - y2 and 2xy, then which expression equals the hypotenuse? choose all that apply
    9·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Please help :( I don’t get these what so ever!!!
    9·2 answers
  • What is the slope of the line that contains these<br> points?<br> х 5 6 7 8<br> y -3 -1 1 3
    10·1 answer
  • (-1 – 3n) + (6 + 2n<br> )<br> Help?
    8·1 answer
  • 1. Eddie ordered customized cups. He was
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!