1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kicyunya [14]
3 years ago
11

Other than using financial aid options offered to him what are some creative ways he can make ends meet

Biology
1 answer:
Len [333]3 years ago
3 0

Working a side job at nights or on the weekends

You might be interested in
In fruit flies long wings (W) are dominant to short wings (w).
lina2011 [118]
The genotype, I believe would be the dominant long wings (W). Hope this helps!

3 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
The arteries that branch from the aorta and provide blood to the heart muscle itself are _______________ arteries.
Anna11 [10]
Coronary artery.....are the arteries that provide blood to the wall of heart !
6 0
3 years ago
Read 2 more answers
The complement system is a ___ barrier of the immune system
m_a_m_a [10]
Biochemical- apart of the second defense system
8 0
3 years ago
Read 2 more answers
30 POINTS
Talja [164]
Anemia is a condition where there is deficiency in healthy red blood cells or hemoglobin resulting in pallor or weakness. It results in low level of hemoglobin which is the protein that transports oxygen around the body. Lack of oxygen in the body will result to weakness, shortness of breath and dizziness. Nikoleta's symptoms of malaise, lethargy and being tired is usually caused by too much work of the heart. In anemic patient, the heart has to pump faster than normal because it has to supply red blood cells around the body. Since the heart is working double-time, it usually results to being tired, lethargic and malaise of the person with anemia. Nikoleta's pale skin is attributed also on the fact that she has low supply of red blood cells around the body. If Nikoleta is lethargic and always tired, little things may irritate her immediately, hence, her being cranky
8 0
3 years ago
Other questions:
  • The majority of ozone that protects against the high energy radiation of the sun is found in the ________.
    10·1 answer
  • The ribosomes of plant cells are sites for the synthesis of?
    7·1 answer
  • What does hypnosis do?
    13·1 answer
  • What happens to the pressure as you travel down
    9·2 answers
  • Which is not caused by bacteria?
    13·2 answers
  • Can anyone help me out?​
    8·1 answer
  • Which elements makes up most of earth’s atmosphere
    6·2 answers
  • Which of the following describes research that would be considered basic science? A. A professor at a university is observing th
    13·1 answer
  • Which is the least commonly suggested method for preventing musculoskeletal diseases and disorders?
    9·1 answer
  • Match the following terms with their best/ most reasonable descriptions: Group of answer choices self-propagating mechanism by w
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!