Answer: Energy transfer could come through condoctours (metal, or copper) to another object to power a bulb, speaker or any other electrical gizmo. (This can get a brainliest answer)
Answer:
Carbon dioxide enters the alveoli, and oxygen enters the capillaries.
Explanation:
This describes the exchange of gases in the lungs. When blood from the rest of the body gets to the lungs through the capillaries, oxygen flows from the alveoli which are tiny air sacs in the lungs, into the blood in the capillaries.
Carbon dioxide from the blood brought to the lungs will then flow into the alveoli which will then expel it through the nose. This repeated process ensures that the body keeps getting oxygen and expelling carbon dioxide.
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
A different form of a gene
Answer:
The tree absorbs light energy from sunlight, converting the light energy into chemical potential energy stored in chemical bonds. The tree uses this energy to build leaves and branches and fruit. When the apple hits the ground, kinetic energy is transformed into heat energy.
Explanation: