1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rina8888 [55]
3 years ago
11

Variation is important within a species because...?

Biology
1 answer:
LekaFEV [45]3 years ago
8 0
survival and adaptability of a species<span>. </span>
Hope this helps(: 
You might be interested in
What procedure did you use to complete the lab <br> The Lab Name Is Energy Transfer.
n200080 [17]

Answer: Energy transfer could come through condoctours (metal, or copper) to another object to power a bulb, speaker or any other electrical gizmo. (This can get a brainliest answer)

3 0
2 years ago
Read 2 more answers
What process takes place at the boundary between the capillaries and the alveoli?
Schach [20]

Answer:

Carbon dioxide enters the alveoli, and oxygen enters the capillaries.

Explanation:

This describes the exchange of gases in the lungs. When blood from the rest of the body gets to the lungs through the capillaries, oxygen flows from the alveoli which are tiny air sacs in the lungs, into the blood in the capillaries.

Carbon dioxide from the blood brought to the lungs will then flow into the alveoli which will then expel it through the nose. This repeated process ensures that the body keeps getting oxygen and expelling carbon dioxide.

5 0
2 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Question 11 (1 point)
pishuonlain [190]
A different form of a gene
3 0
3 years ago
The production of apple on a tree is the result of what energy conversion​
Masteriza [31]

Answer:

The tree absorbs light energy from sunlight, converting the light energy into chemical potential energy stored in chemical bonds. The tree uses this energy to build leaves and branches and fruit. When the apple hits the ground, kinetic energy is transformed into heat energy.

Explanation:

5 0
3 years ago
Other questions:
  • Two heterozygous white (brown fur is recessive) rabbits are crossed
    15·1 answer
  • A difference between bacteria and archaea is
    15·1 answer
  • Does oversteaming brocooli kill the nutrients? reddit
    15·1 answer
  • How do an increase in the organic matter in soil and an increase in soil depth affect the population of plants in an area? A Lar
    15·1 answer
  • Lysosomes break down —————- materials. plant cells have ————- vacuoles than animal cells.
    9·1 answer
  • What ethical issues are associated with medical uses of dna technology
    15·1 answer
  • The what surrounds the heart in humans
    10·1 answer
  • Identify the plankton
    7·1 answer
  • Field mustard is an annual plant that grows wild in many regions of the world. It has small yellow flowers and is pollinated by
    8·1 answer
  • I have a biology question to ask.....
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!