1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
galben [10]
2 years ago
8

Chesapeake Bay Blue Crab Population

Biology
2 answers:
Firlakuza [10]2 years ago
7 0

Answer:

1,3,4

Explanation:

Elina [12.6K]2 years ago
5 0

Answer:

2 and 3

Explanation:

You might be interested in
Baldness (B) is inherited as X-linked dominant disease. An affected male marries a homozygous recessive female. What is the prob
torisob [31]
This can be solved with Punnett squares. The affected male has the X^{B} y genotype, and the female is homozygous recessive. This means that she does not carry this, and therefore, will have the genotype XᵇXᵇ

While doing this Punnett Square, keep in mind that in order to have the male offspring affected, their genotype has to be X^{B} y

Since there are no X^{B} y, the probability of their male offspring inheriting this disease is 0%

5 0
2 years ago
Aldosterone is secreted in response to changes in: select one:
viktelen [127]
Aldosterone is secreted in response to changes in

C. blood pressure
3 0
3 years ago
during a natural disaster part of a plnt was damaged if the plant can no longer grow and produce new root cells which of the pla
Usimov [2.4K]

The question is incomplete as it does not have the options which are:

A. Phloem

B. Xylem

C. Apical meristem

D. Root cap

Answer:

The correct answer will be option- Root cap

Explanation:

The plant growth takes place not only above the surface but below the surface also in the roots. Roots continually grow to absorb more water and nutrients to support the growth of the plant.

The roots are protected by a layer of protective cells forming a structure called root cap below the root. The root cap protects the roots, secretes a substance which helps the growth of the root and the sense gravity.

In the given question since the roots are not able to grow therefore the damaged part will be the root cap.

Thus, the root cap is the correct answer.

8 0
2 years ago
3 facts about angiosperms
N76 [4]

Answer:

Angiosperms are the most advanced and beneficial group of plants. They can grow in various habitats as trees, herbs, shrubs, and bushes. The angiosperms originated about 250 million years ago and comprise 80% of the earth. They are a major source of food for humans and animals.

Explanation:

8 0
2 years ago
Read 2 more answers
if a man with type ab blood marries a woman heterozygous for type A what is the probability that their child would be type B???
Anna11 [10]

Answer:

1/4.

Explanation:

Via a punett square, the only possible combinations are AA, AB, AO and BO. Since BO is the only way the child has type B, the chances are 1 in 4.

8 0
2 years ago
Other questions:
  • Which of the following is not a symptom of the second line of defense, the inflammatory response?
    5·1 answer
  • Vitamin D precursors are produced in the skin in the presence of sunlight. These chemicals are important for the transport of so
    11·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following is NOT a conifer? ginkgos
    12·2 answers
  • Pairs of the same chromosome as found in a karyotype are called homologous chromosomes. True False
    11·1 answer
  • Which of these options is a simple sentence? Select one: a. This cave is full of bats; I don't want to go inside! b. I don’t wan
    6·1 answer
  • What is the name of a baby goat?
    8·2 answers
  • A police officer visits Ms. Duhaime's first-grade class one morning to talk about safety precautions at home and on the street.
    13·1 answer
  • Stabilizing selective pressures result in _______. a. rapid, broad evolutionary changes b. limited evolutionary changes c. an in
    6·2 answers
  • What three body systems help maintain body temperature?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!