1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
harina [27]
3 years ago
8

What is 31 divided by 216

Mathematics
1 answer:
Wewaii [24]3 years ago
6 0

216/31=6.967741935483870967741935483871

simplify and you get 6.97

You might be interested in
WHAT MONOMIAL MULTIPLIED BY -3X^3Y EQUALS 18X^9Y^4
Morgarella [4.7K]
-6x^3y^4
I think that is the answer but i don't know
5 0
3 years ago
A drawer contains 10 pairs of socks. Each pair is either black or white. What is the minimum number of socks that must be drawn,
Brums [2.3K]

Answer:

6

Step-by-step explanation:

7 0
4 years ago
Will someone please please help me
Naddika [18.5K]

Answer:

Step-by-step explanation:

12 + 5 = 17

square root of 9 = 3

5 x 4 = 20

5 0
3 years ago
In Evan's senior class of 240 students, 85% are planning to attend college after graduation. What is the probability that a seni
sveta [45]

Answer:

36% ,hope this helps

Step-by-step explanation:

1) 100 - 85  = 15

2) 240 times 15 devided by:100

3) equals 36

4) 36 %

7 0
4 years ago
Please help, will give brainliest :)
miv72 [106K]

Answer:

1. 2x + 3y = 25

2. Multiply the first equation, x + y = 11, by 2, to cancel out x

3. 8

4. 3

4 0
2 years ago
Other questions:
  • Please help asap 40 points
    7·2 answers
  • Homework answers plz
    6·2 answers
  • Rollout a cube probability of number being greater than 6
    6·1 answer
  • Find the square root of 64009 long diviton <br>​
    12·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Determine the value of x
    13·1 answer
  • In ΔNOP, the measure of ∠P=90°, NO = 49 feet, and OP = 19 feet. Find the measure of ∠N to the nearest degree.
    11·1 answer
  • Please answer this now!!
    15·1 answer
  • The result of adding 14 to twice a number is the same as subtracting 8 from four times that number. Find that number.
    7·1 answer
  • The interest paid on a $8,000 loan is $600, a rate of 4%
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!