1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
allochka39001 [22]
3 years ago
9

Humans are a. vertebrates b. chordates c. all of these d. animals

Biology
1 answer:
PilotLPTM [1.2K]3 years ago
6 0

Answer:

c. all of these

Explanation:

Humans are animals as they are multicellular eukaryotic organisms that are mobile, heterotrophic and can reproduce sexually.

On further classification they belong to the phylum chordates as they possess the five anatomical features present in this phylum at some point in their lives. These features are presence of notochord, endostyle, pharyngeal slits, tail and dorsal nerve chord. They also have bilateral symmetry and possess a coelom.

Humans can be further classified as vertebrates as they possess the vertebral column. It is also known as backbone or spine and is characterized by segmented bone series separated by intervertebral discs. Hence, humans are animals, chordates and vertebrates.

You might be interested in
Why is it hotter in in a attic compared to a bacement
vlabodo [156]
Usually basements are cold and attics are hot 1 reason why is most times attics are small and basements are  big the bigger the more room for the hot air to spread out and ussually  attics are all stuffed up with boxes and stuff
7 0
3 years ago
Read 2 more answers
What determinant of mean arterial pressure would be directly affected by lasix, and would this typically raise or lower mr. unde
Marysya12 [62]
<span>By definition, the two determinants of mean arterial pressure are cardiac output and total peripheral resistance. It has been shown that Lasix decreases cardiac output and total peripheral resistance. Diuretics increase urine production, so it will lower mean arterial pressure.</span>
5 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
When you were testing the ciliospinal reflex and only stimulated the left side of the subject, was the response reflex contralat
natulia [17]

Options: A. contralateral

B. ipsilateral

C. both

Answer:B. ipsilateral

Explanation:The ciliospinal reflex which is also known bas pupillary-skin reflex is usually made uo of the dilation of the ipsilateral pupil this dilation is in response to pain applied to the neck, face, and upper trunk.

If you stimulate the left side of the subject, the response will be only in the ipsilateral which means the stimulation will be felt in the same side of the subject which in this case is the Left side if the subject.

5 0
3 years ago
In your own words: What is the study of ecology?
nadezda [96]

Answer:

Ecology is the study of organisms and how they interact with the environment around them. ... Changes in ecosystems can result from many different factors including diseases among the organisms living in the area, increases in temperature, and increased human activities.

Explanation:

7 0
3 years ago
Other questions:
  • When two plates collide it is at this type of boundary.
    8·1 answer
  • As you hike from the base of a mountain to the top of a mountain, you would expect see decreasing levels of biodiversity.
    14·1 answer
  • Nurses who are pregnant or may become pregnant should not handle which drugs if they are crushed or broken due to the drugs' sub
    11·1 answer
  • What is the difference between coniferous and deciduous trees
    7·1 answer
  • How many genes code for each protein produced
    6·1 answer
  • Although most DNA mutations are harmful, some can be beneficial to an organism. true or false
    9·2 answers
  • Is HIV virus living or non living
    15·1 answer
  • The backbone of DNA and RNA is composed of?
    12·2 answers
  • The picture below shows the devils Millhopper sinkhole in Florida.
    12·1 answer
  • Name the three particles atoms are made up of.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!