No they are not whales are
Genetic material is being duplicated during C. Interphase of the cell cycle.
The best answer is C.
Plant cells are surrounded by a cell wall and have chloroplasts whereas animal cell do not.
The cell wall is a covering that is rigid whose main purpose is to protect the cell and give structural support as well shape to the plant cell. The equivalent of a cell wall in animal cell is the cell membrane, which has distinct differences from the plant cell wall.
Chloroplasts are plant cell organelles which carry out photosynthesis by which plants make their own food. These are absent from animal cells because animals do not make their own food, they ingest it from external sources.
The correct option is B.
For a mature woman, each month the increased level of estrogen hormone leads the pituitary gland to secrete luteinizing hormone. Once this hormone is secreted, the ovary releases a single egg which moves down to the lining of the uterus. If fertilization does not occur, the egg is shed together with the lining of the uterus in a monthly process called mensuration. If fertilization occur, then the fertilized egg attach to the lining of the uterus and placenta is formed. The fertilized egg then send signal to the ovary to keep secreting progesterone, which will sustaining the pregnancy by keeping the uterus lining thick and nourishing for the developing embryo.
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
