1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivanzaharov [21]
3 years ago
12

Many common products, such as wooden furniture, paper, and books, are made from trees. Which of the following is a likely conseq

uence of humans cutting down a forest in order to make use of the natural resources there?
Biology
1 answer:
vredina [299]3 years ago
6 0
Well, if humans cut down trees, there won't be as much oxygen, because trees give us oxygen.
Also, the habitats of animals might be destroyed.
You might be interested in
Half of the polar bears in a small population die. This population may experience changes due to
cupoosta [38]
Climate change is the choice that answers your statement
7 0
3 years ago
Read 2 more answers
Which of the following statements is the most likely explanation for plant withering due to leaky membranes in cold temperatures
podryga [215]

Answer:

C. H+ ions do not accumulate inside the thylakoid, so ATP synthase makes too little ATP.

Explanation:

Plant withering refers to the virtual death of plant cells due to lack of food. During the light-dependent reactions of photosynthesis, ATP needed for the synthesis of sugar (food) is created in the thylakoid membrane of the CHLOROPLAST of plant cells.

In the light-dependent reaction, hydrogen ions (H+) builds up/accumulate in the thylakoid lumen to create an electrochemical or proton gradient i.e. a difference in the concentration of H+ ions across the membrane. The hydrogen ions passes through a protein complex called ATP synthase, which forms ATP from ADP (by adding phosphate group), from the energy generated by the electrochemical gradient formed as a result of hydrogen in (H+) build up.

Hence, a plant that possess leaky membrane due to the cold temperature will likely wither because H+ ions are not able to accumulate inside the thylakoid causing a proton gradient, so ATP synthase makes too little ATP.

4 0
3 years ago
Mitosis worksheet help
Lubov Fominskaja [6]

Answer:

The answer to your question is below

Explanation:

1.- Prophase

2.- Metaphase

3.- A

4.- centrosomes

5.- Interphase

6.- D, A, C, F, E, B

7.- Animal cells, because plant cells have a cell wall that is a rigid structure that can be divided but gives support to the plant cell and in this picture, the cells do not this structure.

8.- Interphase

9.- Because cells can reproduce and newborn cells replace the old ones.

5 0
3 years ago
Read 2 more answers
All of the following are true of spermatogenesis EXCEPT: Question 18 options: DNA replicates once, but cells divide twice. The p
jolli1 [7]

Answer:

  • One spermatogonium produces 4 spermatids FALSE. One primary spermatocyte produces 4 spermatids.

Explanation:

Germ cells are diploid reproductive cells in charge of gamete production. Germ cells divide by mitosis and meiosis. Through mitosis, they originate more sexual cells, but through meiosis, they produce gametes -sperm and egg cells-. This process is known as gametogenesis.

Gametes´destiny is to merge during fecundation, and a new diploid cell called zygote emerges through fertilization. The zygote is a complete cell and suffers successive mitosis to form the new organism.

Spermatogenesis is the process of production and maturation of sperm cells. Spermatogonia are the masculine diploid germ cells, carrying 46 chromosomes. These germ cells suffer mitosis to reproduce. Some of them stay as spermatogonia, and some others become primary spermatocytes, which are in charge of gamete production. Primary spermatocytes are also diploid cells, meaning that they still carry 46 chromosomes.

Each primary spermatocyte replicates its genetic material and then goes through meiosis I to produce two daughter haploid cells called secondary spermatocytes, each of them carrying 23 chromosomes. Each secondary spermatocyte will produce two other haploid daughter cells by meiosis II.

The total result from the two cellular divisions of each primary spermatocyte is four haploid daughter cells called spermatids.

During spermiogenesis, spermatids mature into spermatozoa or sperm cells. Each sperm cell characterizes by being composed of a head, midpiece, and tail.

  • DNA replicates once, but cells divide twice TRUE
  • The products are spermatozoa that each have a head, midpiece, and tail TRUE  
  • Spermatids containing 23 chromosomes (1n) are produced TRUE
  • One spermatogonium produces 4 spermatids FALSE. One primary spermatocyte produces 4 spermatids.
  • Genetically diverse spermatids are created TRUE
4 0
2 years ago
Which statements are accurate? Select two options.
denis-greek [22]

Answer:

The correct answers are

A.Layer C is younger than layer A.

B. Layer B is younger than layer A but older than layer D.

Explanation:

just took the test and got it right

3 0
3 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Elements are pure substance consisting of only one type of atom and are catergorized on the periodic table element. For each of
    7·1 answer
  • Something caused by injury is termed iatrogenic. true false
    8·2 answers
  • Which term describes parts of organisms that have a similar function but not a similar structure?
    15·1 answer
  • Parents can pass on chromosomes to their children that are different than their own when the new gene combinations are created b
    6·2 answers
  • Use photosynthesis in a sentence
    14·1 answer
  • All the members of a species they live in an area make up
    8·1 answer
  • Identify specific phases of mitosis: prophase, metaphase, anaphase, telophase
    5·1 answer
  • I don't know the other 3. By the way the words to use are at the bottom
    13·2 answers
  • Which of the following is not an extensive physical property ?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!