1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gemiola [76]
3 years ago
8

Read the following scenario to answer the following question. An abundant and continual supply of ATP is necessary for all livin

g cells. Active muscle cells require an extraordinary amount of ATP to permit strenuous exercise for prolonged periods. Toxins, reduced blood flow, and a compromised respiratory system can interfere with the transport of oxygen to active cells. A runner in a marathon faces multiple obstacles to continue to produce sufficient ATP to remain competitive. Breathing faster when we exercise is necessary to expel ________.
Biology
1 answer:
Kobotan [32]3 years ago
3 0

Answer: Carbon dioxide and also bring in more oxygen for supporting the aerobic metabolism

Explanation:

 The aerobic metabolism is one of the type of process in which the body basically helps in creating the energy in our body by the process of combustion of the fats and carbohydrates in the oxygen presence.

According to the given scenario, when we doing exercise the breath become more faster and at that specific time it is very important to expel the carbon dioxide and then inhale more oxygen for supporting the aerobic metabolism in the our body system.

 Therefore, The given answer is correct.      

You might be interested in
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
Identify the feature of life that is illustrated by each of the following statements. NOTE: You may use terms other than the cha
maria [59]
What subject is this for ?
5 0
3 years ago
What is the climate and weather information of freshwater wetlands
ziro4ka [17]

Answer:

The average temperature of a freshwater wetland in summer is 76 degrees Fahrenheit. The average temperature in winter is 30 degrees Fahrenheit. The climate in freshwater wetlands is usually semitropical, as freezing conditions rarely occur.

Explanation:

The most common freshwater wetland is swampland. The freshwater biome is located on every continent except for Antarctica. Most people think of it being a nuisance, but freshwater wetlands are an important part of our ecosystem. More examples of freshwater wetlands are marshes or bogs. In freshwater wetland the water will always be standing water. Most of them will have water in them all of the time, but some will only have water in them during certain parts of the year. There are 4 different seasons in freshwater wetlands. There is Summer, Fall, Winter, and Spring. The average temperature of a freshwater wetland in summer is 76 degrees Fahrenheit. The average temperature in winter is 30 degrees Fahrenheit. The average rainfall in a freshwater wetland is 59 inches or 150 centimeters to 200 inches or 500 centimeters. The freshwater wetlands get and average of 7-10 hours of sunlight a day throughout the year.

4 0
3 years ago
Benign tumor of the adrenal medulla that causes the gland to produce excess epinephrine is called
Yuki888 [10]

Answer:

A pheochromocytoma is a tumor in the adrenal gland. It causes the gland to make too much of the hormones epinephrine and norepinephrine.

Explanation:

7 0
3 years ago
What are some of the resources organisms compete for?
exis [7]
They compete for food, water and space
5 0
3 years ago
Other questions:
  • Hi if you could please help with these biology questions it would be greatly appreciated!
    9·2 answers
  • Whether the organism is a pea plant or a human being, the information in the DNA of the cell's nucleus directs synthesis of prot
    8·1 answer
  • An animal cell: the human body. Different but also alike. Your blood vessels, veins, and arteries are like a transportation syst
    11·2 answers
  • Chapter 19- The Cardiovascular System: The Blood Choose the single best answer to each question.
    6·1 answer
  • Compare the properties of the parent and daughter cells in mitosis and meiosis and explain the reason for any differences. it ne
    5·1 answer
  • Hey scientist observes that a species of insect appears to be more numerous during dry summers then wet summers. Which is the ne
    14·1 answer
  • Make it good this teacher is being difficult ( I will report answers that just answered for points!!!!)
    15·1 answer
  • Which of the following is NOT a way to conserve and/or protect natural resources?
    10·1 answer
  • What organelle is a neuron cell missing, if it can't divide, and how does this help it perform its function? ​
    9·1 answer
  • Acquired specific immunity involves the response of:_______
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!