1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rzqust [24]
3 years ago
14

These are the smallest units that retain all of the properties of their type of matter

Biology
1 answer:
Ierofanga [76]3 years ago
5 0
I believe it would be an atom
You might be interested in
The first step in annotating a gene is identifying the open reading frame. In bacteria, all genes that code for a protein have a
kirza4 [7]

Answer: 6

Explanation:

A DNA strand has 3 distinct frame, thus for both strands, it will require 6 strands.

4 0
3 years ago
When chlorophyll absords sunlight,it gives it to which particles​
Sedaia [141]

Answer:

Chlorophyll gives the sunlight to the plant which is how photosynthesis happens

4 0
4 years ago
What is used in light-dependent reactions to split water?
sukhopar [10]
C.Sun Light hope this helps.....
5 0
3 years ago
Read 2 more answers
Does fitness as used in biology and survival have the same meaning? Why or why not?
xz_007 [3.2K]

Explanation: The biological fitness of an organism is dependent on its ability to survive and reproduce in a given environment. A trait that increases ability to survive, but makes an individual sterile, decreases fitness because the organism cannot produce offspring to carry on the trait.

thank you

please mark as brainliest

7 0
3 years ago
Which of the following best describes the hydrolysis of carbohydrates
PIT_PIT [208]

Answer:

The addition of a water molecule breaks a covalent bond between sugar monomers

Explanation:

The digestion of carbohydrates by enzymes is an example of a hydrolysis reaction.

Carbohydrates are chains of monosaccharides. Hydrolysis involves the addition of a water molecule that cleaves the covalent bond between the molecules of sugar.

The reverse reaction is a condensation reaction, the joining of sugar monomers to create a carbohydrate releases a molecule of water.

4 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How do organisms get the energy they need
    7·2 answers
  • What type of organism moves using cilia
    6·2 answers
  • Arbon dioxide is not considered an organic molecule. Photosynthetic organisms turn it into an organic molecule in the form of a(
    13·1 answer
  • Some evidence that vaccines are effective.
    11·1 answer
  • An increase in which of the following factors is likely to contribute to competition between two members of the same species liv
    5·1 answer
  • What impact do you think 3d printing could have on the future of science?​
    10·2 answers
  • Explain why a scientist should or should not change a theory based on one experiment?
    12·1 answer
  • Help!!! How do you feel about the idea of using CRISPR and other genetic modification technologies on humans? Is this a good ide
    11·2 answers
  • Who developed the theory that diseases only have natural causes?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!