1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Luba_88 [7]
3 years ago
7

Does a virus grow or not

Biology
2 answers:
inysia [295]3 years ago
5 0

Answer:

No virus's don't grow

Explanation:

Viruses cannot eat food or grow on their own, but they can make more of themselves if they live inside the cells of other organisms, called "hosts". The viruses attack those host cells and make more of themselves.

Hope this helped!

Gelneren [198K]3 years ago
3 0

answer: a virus does not grow.

Explanation:

You might be interested in
Once arriving at the ribosome, which process will begin next?
AysviL [449]

Answer:

Translation of genetic code for protein formation

Explanation:

8 0
3 years ago
On your first research mission you make an amazing discovery by finding a new species living in the hostile environment of the s
Tomtit [17]

The best classification for this new species is Animalia.

According to the six kingdom classification given by Carl Woese, all organisms are divided into 6 kingdoms.

1) Archaebacteria

2) Eubacteria

3) Protista

4) Fungi

5) Plantae

6) Animalia

As the newly discovered species is a multicellular (made up of more than one cell) organism.

Then it can only belong to Kingdom Fungi, Plantae and Animalia as the rest of the kingdoms like Archaebacteria, Eubacteria and Protista consist of unicellular organisms that are made up of only one type of cell.

Now this species is not autotrophic ( i.e. an organism that can get its own nutrition by the use of light, water, carbon dioxide, or other substances).

It means it is heterotrophic which means it can't get nutrition on its own.

Out of the Fungi, Plantae and Animalia , only fungi and Animalia kingdoms consist of heterotrophic organisms.

Now this species also does not contain chitin which is an important characteristics of Fungi.

So only option left is Animalia.

Hence, the best classification for this new species is Animalia.

Learn more about Six kingdom classification here brainly.com/question/14965544

#SPJ1

6 0
2 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
What do convection currents mean?
Dimas [21]

Answer:

Convection currents transfer heat from one place to another by mass motion of a fluid such as water, air or molten rock.

Explanation:

7 0
2 years ago
What is the best defenition of bias
agasfer [191]
Any factor that causes distortion of genetic predictions.
8 0
3 years ago
Other questions:
  • Simple Animals use their ____ as an exchange point for materials
    11·2 answers
  • What happens if a bacterial cell lands in a jar of jelly?
    11·1 answer
  • Humans are predators. true or false
    13·2 answers
  • Hey y'all can you help me with a biology question, would really appreciate it :)
    7·1 answer
  • When bile breaks apart large globules of fat, the process is known as:?
    9·1 answer
  • when you boil water on the stove and steam will rise from the pan which is this is a true statement right as the water begins to
    11·1 answer
  • Dinfenfenfujefebfue.
    13·1 answer
  • HOW CAN WE BE GOOD AN CHEERFUL
    6·2 answers
  • 3. Which of the following elevations is represented by an index contour<br> line?
    15·2 answers
  • 14. Show the cross for two heterozygous guinea pigs.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!