1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ELEN [110]
3 years ago
8

Which type of tide occurs when a coastline is within a tidal bulge?

Biology
2 answers:
zhuklara [117]3 years ago
7 0
A neap tide occurs. :)
Anestetic [448]3 years ago
6 0

Answer:

c. neap tide

Explanation:

You might be interested in
What causes the line indicated by the arrows most likely represent?
Aloiza [94]

Answer:

the answer Is high pressure

8 0
3 years ago
Cerise is a schoolteacher. She is teaching her students that chemicals dumped in the ocean have adverse consequences on humans.
professor190 [17]

E is the correct answer

8 0
3 years ago
What happens if you stop breathing how would your circulatory system be affected
Naddika [18.5K]
If youd stop breathing for so long youd die
8 0
3 years ago
Read 2 more answers
What is the scientific method?
Sholpan [36]

The scientific method is the "process of experimentation" for your hypothesis. There are five steps in the scientific method they consist of: conduct research, form hypothesis, test hypothesis, record data, draw conclusion.

Hope this helps!

8 0
4 years ago
Read 2 more answers
What is aerobic respiration?
Likurg_2 [28]

Explanation:

The respiration which uses oxygen is called aerobic respiration. In aerobic respiration, the glucose food is completely broken down into carbon dioxide and water by oxidation. Aerobic respiration produces a considerable amount of energy for use by the organism which gets stored in the ATP molecules.

5 0
3 years ago
Read 2 more answers
Other questions:
  • 60 POINTS AND BRAINLIEST IF ANSWERED WITH EXPLANATION
    12·2 answers
  • Why is the term lipid bilayer a good name for a cell membrane
    9·1 answer
  • What structure does the human lung have that increases the surface area of the lungs?
    7·1 answer
  • Based on the data, taken at three different time points, which of the following statements best describes what is observed in th
    6·1 answer
  • The scale of a road map indicates that 4 cm is equal to 30 km. Calculate the distance in km between two cities if the road betwe
    13·1 answer
  • What is surface water?
    9·1 answer
  • Which change is an environmental effect of building dams?
    13·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • What movements do the quadriceps femoris muscles perform?
    7·1 answer
  • A triathlete swims a distance of 3 kilometers in 1 hour, then bikes a distance of 50 kilometers in 3 hours, and finally then run
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!