A/An ____________________ is a technique of mechanically widening a narrowed or obstructed blood vessel.

Biology

1 answer:

dexar [7]3 years ago

4 0

Answer:

Angioplasty

Explanation:

Angioplasty is a technique of mechanically widening narrowed or blocked blood vessels. In angioplasty the doctors insert a deflated balloon in the narrowed vessel and then inflate it to fixed size. Thats why it is also known as baloon angioplasty.

Balloon push the walls of vessels for increases blood flow. Sometime a stent is also inserted immediately after angioplasty to ensure that blood flow remain intact and balloon is removed by deflating it.

Angioplasty may of several types depending upon the blood vessels it open such as coronary angioplasty, peripheral angioplasty and renal angioplasty.

You might be interested in

Human blood has a pH of 7.4. How do buffers in the blood affect the pH?

ikadub [295]

Answer:

I think buffers prevents small amounts of acids and blood from coming and changing the pH of the body, because the buffers are barriers that do not let blood and acid pass through.

Hope it helps!

6 0

2 years ago

All living things need to transport molecules from one place to another within the body in order to carry out necessary life

nataly862011 [7]

Answer:

I think it is A The cohdsive behavior of water molecules make it easy to transport throughout the body.

Explanation:

8 0

3 years ago

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

IgorC [24]

Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations

5 0

2 years ago

Which of the following is true regarding the glucose transporter? A. in addition to glucose, it will transport any other monosac

emmainna [20.7K]

Answer:

B. binding of glucose causes a conformational change so that the transporter is never open on both sides of the membrane

5 0

3 years ago

25 points! will mark brainliest! Which cell division phase is shown in the image?

nikdorinn [45]

E) cytokinesis is the answer

7 0

2 years ago

Read 2 more answers