Secretary of defense is ahead but not a soldier in rank
In ranking its the general (which is the highest rank in the army)
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
"C. Organisms' characteristics are carried
<span> on DNA.</span>" would be the best fit, although this still isn't really the core idea behind natural selection, which is that animals survive based on how "fit" they are for their environment.
Answer;
Light microscope
Explanation;
A light microscope uses focused light and lenses to magnify a specimen, usually a cell.
Light microscopes may be simple microscopes or compound microscopes.
Simple microscopes uses a single lens to magnify an object and cannot reach high magnification.
Compound light microscopes use two sets of lenses that is; an objective lens and an eyepiece, to produce images.
