Answer:
A eukaryote is an organism with complex cells, or a single cell with a complex structures. In these cells the genetic material is organized into chromosomes in the cell nucleus. Animals, plants, algae and fungi are all eukaryotes. There are also eukaryotes amongst single-celled protists.
The correct answer is - C and D.
The principle of original horizontality means that the rock layers have been order by age, with the layers at the top being the youngest, while the layers at the bottom being the oldest.
In this picture it is little hard to tell which rocks belong to the same layer from first look because there are multiple twists and turns, an uneven surface, caused by pressure on the crust.
By carefully examining the image though, we can trace the layers more properly and see which ones are younger, which older, and which have the same relative age. In this case, we can see that the markings C and D are actually on the same layer of rocks, thus being a good indication that they have the same relative age.
Answer:
The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.
Explanation:
Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.
If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:
<u>Exercise 1:</u>
- DNA ATACGAAATCGCGATCGCGGCGATTCGG
- mRNA UAUGCUUUAGCGCUAGCGCCGCUAAGCC
- CODON UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
- AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
- Amino acid Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser
<u>Exercise 2: </u>
- DNA TTTACGGCCATCAGGCAATACTGG
- mRNA AAAUGCCGGUAGUCCGUUAUGACC
- CODON AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
- AntiCODON UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
- Amino acid Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
The orca, or killer whale, for example, is actually the largest member of the dolphin family. Dolphins are by far more prevalent than porpoises. Most scientists agree that there are 32 dolphin species (plus five closely related species of river dolphin) and only six porpoise species.
I really hope this answer helps you out! It makes my day helping people like you and giving back to the community that has helped me through school! If you could do me a favor, if this helped you and this is the very best answer and you understand that all of my answers are legit and top notch. Please mark as brainliest! Thanks and have a awesome day!
