1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gekata [30.6K]
4 years ago
15

Genes that are linked together ____.

Biology
1 answer:
Alona [7]4 years ago
6 0
They combine to form traits.
You might be interested in
Fetal benzodiazepine syndrome has not been medically documented. <br> a. True <br> b. False
ipn [44]

Answer- FALSE


Fetal benzodiazepine syndrome is a condition of infants which is caused by the use of benzodiazepine by the mother during pregnancy. Children with this syndrome often present with malformed face, delayed mental development and learning disabilities, poor coordination, poor muscle tone, and tremors.

5 0
3 years ago
What changes igneous or sedimentary rock into metamorphic rock?
meriva

Hi there!

Question - What changes igneous or sedimentary rock into metamorphic rock?

Elite Answer - A heat and pressure

Why - Due to immense and heat and pressure it can change igneous or sedimentary rock into metamorphic rock.

Hope This Helps :)

5 0
3 years ago
What is the species name for pezizales
ikadub [295]
The Pezizales are an order of the subphylum Pezizomycotina within the phylum Ascomycota.
7 0
3 years ago
The amount of sun energy reaching Earth that reflects back into space is about one
Veseljchak [2.6K]
The answer is c. last time i had that and my teacher said it was c


4 0
3 years ago
What allows some individuals to have an advantage over others of the same species
aev [14]
It’s B, having variation from sexual reproduction because the two parent mix genetic information so they have more of an advantage
6 0
3 years ago
Other questions:
  • What do the “nodes” in a cladogram represent?
    15·2 answers
  • What is a consentration gradient
    6·1 answer
  • Describe the arrangement within energy levels of the six electrons of an atom of carbon
    10·1 answer
  • What is the meaning of H20​
    12·2 answers
  • What event occurs in photosystem 1?
    14·1 answer
  • I don't understand this
    11·1 answer
  • 6. The height of tides changes throughout the day mainly because
    11·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What does disagreement between scientific knowledge
    8·1 answer
  • What is the maximum number of amino acids that could be coded for by a
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!