1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olenka [21]
3 years ago
15

What are the sources of acid deposition

Biology
2 answers:
Leni [432]3 years ago
4 0
Google wil give more information
Thepotemich [5.8K]3 years ago
4 0

Answer:

Sources of Acid Deposition

The primary emissions responsible for acid deposition are sulfur dioxide (SO2) and oxides of nitrogen (NOx) from the combustion of coal, oil and natural gas. The combustion compounds are transformed into sulfuric and nitric acid and transported downwind before they are deposited.

Hope it helps!

You might be interested in
How can you consider aquarium as an example of ecosystem?​
Daniel [21]

Answer:

An aquarium can therefore be described as a closed artificial ecosystem in which fish and plants are able to find a habitat where they can grow and develop in a healthy and balanced way. Each aquarium must therefore be consciously designed, developed and managed to facilitate the establishment of the virtuous cycles that occur spontaneously in nature and give rise to the interactions.

5 0
2 years ago
What are the main differences between the two ecosystems in terms of organism population?
12345 [234]
Ah ok! The difference would be the factors, they’re included in each level of organization!

Explanation:
First, let's review biotic and abiotic factors.

Biotic factors are living organisms, an example would be a deer.

Abiotic factors are non-living objects, an example would be the air.

Population - All the members of one species that live in a defined area.

Community - All the different species that live together in an area.

Ecosystem - All the living and non-living components of an area.

I hope this helped a bit ^^
6 0
3 years ago
Drag the tiles to the correct boxes to complete the pairs.
ohaa [14]

Answer:

Explanation:

the dna replicates goes to mitosis along with the nucleus divides

the cytoplasm divides goes to cytokinesis then i think interpahse goes with this one

5 0
3 years ago
I think it’s A but I’m not sure can some help
victus00 [196]

Answer:

C.

Explanation:

This is because cellular respiration produces C02, which photosynthesis uses.

3 0
3 years ago
A student is experimenting with a substance that moves into the cell via facilitated diffusion. The student notes that as the co
Drupady [299]

Answer:c

Explanation:

5 0
4 years ago
Read 2 more answers
Other questions:
  • Which of the vitamins is directly linked to the diet of calcium in our body?
    12·1 answer
  • Within the light organ, bacteria are protected and nourished, and rapidly increase in number. At night, they provide the light n
    5·1 answer
  • All living things need energy; it is a requirement for life. In a typical cell, ATP, the high energy molecule, is produced in th
    14·2 answers
  • Lipids are important to living things for all of the following reasons, EXCEPT that they are
    15·1 answer
  • Blood from the lungs is carried back to the heart by the _____.
    13·2 answers
  • Select the correct answer. An object is acted upon by a force of 22 newtons to the right and a force of 13 newtons to the left.
    13·1 answer
  • The cell division that creates gametes according to these principles is known as __________.
    8·1 answer
  • State whether each of the following statements is true or false, and explain your choice: a. The chromosomes in a somatic cell o
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • 31.Animal cells can be found in a...
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!