1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kvasek [131]
3 years ago
13

What do acids do do ph

Biology
1 answer:
Sergio [31]3 years ago
8 0

Answer:

An acid increases the hydrogen ion concentration in a solution, while a base decreases the hydrogen ion concentration. pH is used to measure the concentration of H+ ions ([H+]) and therefore, whether a substance is acidic or basic (alkaline).

Explanation:

Please make mine the brainliest

You might be interested in
When NADH passes its electrons into the Electron Transport System, NADH is chemically:
erik [133]

Answer:

Option D, oxidized

Explanation:

The NADH gets oxidised when it passes its electrons into the Electron Transport System

Oxidization is a process in which one element or compound loses its electron to other chemical element or compound thereby itself getting oxidised and reducing the other one (the one who gains the electron).

Here in the electron transport system, the NADH loses or donates its electron to the Electron Transport System thus chemically it gets oxidized.

Hence, option D is correct

8 0
3 years ago
ONLY ANSWER IF YOURE SURE
OleMash [197]
The answer is 100%. Three are observable, but the fourth is just a carrier.
8 0
4 years ago
Read 2 more answers
The juxtaglomerular cells release the enzyme ______________ when the macula densa cells detect low blood volume or solute concen
zhuklara [117]

Renin enzyme

Renin enzyme are also known as angiotensinogenase and function by regulating the body means arterial blood pressure. They do circulate in the blood stream and digest angiotensinogen that was secreted in the liver into peptide angiotensin 1. Thus, they are secreted by the kidney and placenta.






5 0
3 years ago
How can the "shape" of a protein affect its function?
e-lub [12.9K]

Protein function is directly related to the structure of that protein. A protein's specific shape determines its function. if the structure of the protein is altered because of a change in the structure of the amino acids, the protein becomes denatured and does not perform its function as expected.

8 0
3 years ago
Read 2 more answers
1. Fossils are the _____
Ksivusya [100]
Fos·sil<span>ˈfäsəl/</span>nounthe remains or impression of a prehistoric organism preserved in petrified form or as a mold or cast in rock. 
 so B

6 0
3 years ago
Read 2 more answers
Other questions:
  • Plant and animal cells contain many of the same structures, and those structures carry out the same functions in both types of c
    14·1 answer
  • This cell membrane gateway system is specifically called the
    7·2 answers
  • ___________ may be the cause of impulsive aggression, which can be treated with _________.
    11·1 answer
  • Which type of cell division produces daughter cells that are identical to the original cell?
    12·1 answer
  • If a high pressure system is in place there will be cloudy skies true or false
    8·1 answer
  • When a physical weakness or psychological distress renders a victim incapable of resisting or deterring crime, this is referred
    6·1 answer
  • True or False: Uncertainty is NOT a part of science. True O False​
    15·1 answer
  • Why do a chicken embryo and a cow embryo look very similar even though the adults do not?
    6·2 answers
  • What is the type of eruption of sakurajima volcano?
    13·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!