1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hatshy [7]
3 years ago
6

What Effect does the release of volcanic gases and ash into the air have on long-term climate?

Biology
2 answers:
Svetllana [295]3 years ago
8 0

Answer:

It is 3 just took the quiz

Explanation:

DochEvi [55]3 years ago
3 0

When volcanoes erupt, they emit a mixture of gases and particles into the air. Some of them, such as ash and sulphur dioxide, have a cooling effect, because they (or the substances they cause) reflect sunlight away from the earth. Others, such as CO2, cause warming by adding to the the greenhouse effect.

Please mark Brainliest

You might be interested in
This is an extinct member of the Homo genus known from Pleistocene specimens found in Europe and parts of western and central As
Inga [223]

Answer:

The correct answer will be-<em> </em><em>Homo neanderthalensis</em>

Explanation:

The closest ancestor of modern humans which evolved in the Pleistocene age which was around 7 lakh to 3 lakh years is the <em>Homo neanderthalensis</em> or Neanderthals.

The Neanderthals became extinct around 12,000-10,000 years ago by competitive <em>Homo sapiens</em>.

The specimens of Neanderthals are collected from the central and Western Asia and parts of Europe and showed approximately the same cranial capacity which is around 1450-1500 cc.

Thus, <em>Homo neanderthalensis</em> is the correct answer.

4 0
3 years ago
WILL GIVE BRAINLIEST!!
motikmotik
ANSWER:

Synonyms for light:

flash, glimmer, glint, glitter, scintillation, shimmer, sparkle, twinkle
daylight, moonlight, sunlight, sunshine
afterglow, aureole (or aureola), aurora, beam, halo, ray, shaft, streak, stream, sunbeam
glisten, gloss, luster (or lustre), polish, reflection, sheen

Antonyms for light:

blackness, dark, darkness, dimness, dusk, duskiness, gloom, night, shadow

best of luck!! :)

help me by marking as brainliest!!
4 0
2 years ago
In genetics, the dash symbol (–) is a "wild card" that stands for either the dominant allele or the recessive allele; for exampl
german

Answer:

 12     :    3      :    1

white : yellow : green

Explanation:

Given that genes A and B control the fruit colour in following ways:

A_B_ or A_bb = white

aaB_ = yellow

aabb =  green

The genes undergo independent assortment so:

AaBb X AaBb =

A_B_ : A_bb : aaB_ : aabb

  9     :    3     :   3      :   1

white : white : yellow: green

        12          :    3     :   1

Hence, ratio of white : yellow : green is 12: 3: 1

8 0
3 years ago
Explain how elevation is shown on a topographic map
Lilit [14]
Contour intervals between contour lines
5 0
3 years ago
Read 2 more answers
What is this called the last choice is meiosis
Advocard [28]

Answer:

b binary fission

Explanation:

3 0
2 years ago
Other questions:
  • Draw the non cyclic amp molecule after it has dissolved in water
    14·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A kind of chemical sedimentary rock
    15·2 answers
  • I don't really understand the question.
    5·2 answers
  • What structure is responsible for the opening and closing of the stomata
    10·1 answer
  • The diagram shows the structure of starch, a complex carbohydrate. What best describes the relationship between starch and gluco
    6·1 answer
  • Help me plssssssssssss
    9·1 answer
  • Select the correct answer.
    11·2 answers
  • if several pea plants with the TTYy are crossed withe genotype Ttyy, what percentage of the offspring will be expected to have t
    6·1 answer
  • Read the article to learn more about the disorders that can occur when there is an irregular number of chromosomes. human chromo
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!