Answer:
A. Carbon dioxide travels from the heart to the lungs in pulmonary arteries
Explanation:
Answer:
Being raised in conditions of extreme deprivation is an environmental influence that has the clearest, most profound effect on intellectual development.
Explanation:
An example of a population in which evolution could take place in a relatively short period of time could be pathogenic bacteria exposed to antibiotics.
Answer: Option A
<u>Explanation:</u>
Evolution if takes place within a short period of time say the next generation that is called as micro evolution. This is caused when a specific organism exposed in a different environment at once modifies its genes to suit the new environment. This phenomenon can be very well seen in the pathogenic bacteria which are exposed to antibiotics.
When an antibiotic is prescribed to bacteria initially it nullifies its effect by destroying it. When continuously exposed to a certain antibiotic some bacteria dies but there are few which becomes resistant to it and survives. This on the other hand multiplies producing a generation that can’t be touched by the antibiotic.
Answer:
Answer is below
Explanation:
Frogs and humans share the same basic organs. Both have lungs, kidneys, a stomach, a heart, a brain, a liver, a spleen, a small intestine and a large intestine, a pancreas, a gall bladder, a urinary bladder and a ureter. ... On the whole, their organ structure is similar, but frogs have considerably less complex anatomies
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
