1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
givi [52]
3 years ago
13

Golf courses make use of fertilizers to keep the grass green and healthy. Using your knowledge of osmosis, explain how applying

too much fertilizer might not help the golf course stay green
Biology
1 answer:
Nostrana [21]3 years ago
4 0
Osmosis is the diffusion of water. Water tends to diffuse to the area with a higher concentration of solute. (Particles) In this case, Im assuming the fertilizer is the solute because it contains chemicals. Therefore, since water tends to diffuse to higher concentration of solute, the water in the grass will diffuse out to dilute the fertilizer on the surface of the grass. Without water, the grass will be dehydrated and shrivel up and die. Hopefully you find my answer helpful!
You might be interested in
What organism feeds on dead plants and animals and helps recycle them?
Kitty [74]
Decomposers, like fungus.
3 0
3 years ago
Read 2 more answers
Most plant leaves take in more carbon dioxide as light increases. They give off carbon dioxide if light intensity is too low. Th
stich3 [128]

Answer:

B. Cellular Respiration

Explanation:

Because u have to think which one does the samething as photosynthesis

5 0
2 years ago
Answer the following:
mihalych1998 [28]
A. behavioral isolation is when the plant or animal acts a particular way to attract their counterparts, like mating rituals.

geographic isolation is the natural barrier preventing similar species from interacting. for example, Galapagos Islands are the only home of flightless cormorants because the islands are so far from any other land for them to invade.

Temporal isolation is when two of the same or similar species cannot reproduce as a result of mismatched sexual maturity.

B. the isolation of two frog species by mating call is behavioral isolation.
4 0
4 years ago
What is an example of a eukaryotic cell?
VashaNatasha [74]

Explanation:

Plant cell

Is the best example of a eukaryotic

3 0
3 years ago
Alizarin yellow is a pH indicator that transitions from red to yellow when the pH falls from a value of 11 to below 10. Why is p
nydimaria [60]

Answer:

The correct answer is - acidic conditions wouldn't trigger a change in the color of Alizarin yellow.

Explanation:

The growth of E. coli generally occurs at neutral pH, however, its growth is normal at acidic conditions as well.  The change in the growth of  E. coli is not able to detect by alizarin.

The phenol red turns yellow in the presence of an acid, and the change in pH in an alkaline environment can be detected by the red color of phenol red. Growth of E.coli will grow in pH of 10-12 . But, very slowly. The color change in alizarin is also apparent at pH 10.2 to 12 only.

7 0
3 years ago
Other questions:
  • Help weed this question pls
    15·1 answer
  • What impact has the baby boomer generation had on manufacturing industries in the secondary sector of the economy?
    11·1 answer
  • Chief cells secrete inactive pepsinogen in order to prevent acid erosion inside of the chief cells. True or False
    9·2 answers
  • A heterozygous round seeded plant (Rr) is crossed with a homozygous round seeded plant (RR).
    7·1 answer
  • Formulate a question that could be answered observing chromosomes of different species of animals
    14·1 answer
  • Which lifestyle choices lead to good health? Check all that apply.
    10·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • The table lists information about four different organisms. Organism name Organism type Adaptation lizard animal lays eggs garde
    10·2 answers
  • A. Which line represents travel at the fastest speed? Justify your answer.
    8·2 answers
  • SOLVED How does cell division differ in prokaryotic unicellular organisms vs. eukaryotic unicellular organisms?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!