1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Neporo4naja [7]
3 years ago
14

During a reflex, the brain is told about the action _____. before it happens after it happens neve

Biology
1 answer:
Lapatulllka [165]3 years ago
3 0

Answer:

after it happens

Explanation:

A reflex action or reflex pathway is the pathway that gets activated in the condition or reflex or immediate situations.

During reflex action, the sensory signals are not sent initially to the brain which helps in analyzing the situation but the analysis and interpretation of signals are performed by the spinal cord (a part of CNS) interneurons.

After the motor signals are sent to the effector's muscles, the sensory signals from the spinal cord are then sent to the brain. Therefore, the role of the brain comes later and the brain then analyses that what happened during the reflex action.

Thus, after it happens is the correct answer.

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
DNA is also a ___________ ___________, which means it is composed of thousands of subunits called ________
Mars2501 [29]
I don’t know the first two but the last one the thousands of subunits are called nucleotides
6 0
3 years ago
Could chromosomes 2 be homologous with chromosomes 1
SashulF [63]

Answer:

Homologous chromosomes are two pieces of DNA within a diploid organism which carry the same genes,

7 0
3 years ago
Living material that makes up organisms is known as __________.
Andreas93 [3]

Answer:

the answer is B. biomass

7 0
3 years ago
Read 2 more answers
Write the complementary DNA strand for the strand below TTAAGCGCTAATCGTACT
NISA [10]
AATTCGCGATTAGCATGA

The complementary strand it what matches to the original. T means the complementary letter will be A (and vise versa), C means the complementary letter will be G (and vise versa).
Hope this helps
5 0
2 years ago
Other questions:
  • Action potentials are conducted more rapidly when transmission is
    15·1 answer
  • Select the correct answer
    11·2 answers
  • Explain the role of molecular phylogenetics in revising the traditional classification schemes
    6·1 answer
  • You are starting your own forensics lab and need to purchase the proper elements for polymerase chain reaction (PCR) analysis. I
    9·1 answer
  • Wind with the speed of less than 50 km/h is called
    6·2 answers
  • What happens during inhalation?
    7·1 answer
  • What part of the brain do we use when initiating skeletal muscle movement?
    11·1 answer
  • Which consequences can be caused by overharvesting marine species?
    13·1 answer
  • Citrus has always been the most important crop in Florida.<br> True<br> False
    9·1 answer
  • Consumer programs perform which two of the following functions to protect consumers?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!