1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena L [17]
3 years ago
12

How many different nitrogenous bases do you see?

Biology
1 answer:
Aleonysh [2.5K]3 years ago
5 0

Answer:

There are four different nitrogenous bases.

Explanation:

These four include adenosine, thymine, cytosine, and guanine for DNA. Hope this helped :)

You might be interested in
If body fat has decreased but the scale has stayed the same, this means your client has gained which of the following?
Brums [2.3K]

Answer:

d. Lean mass

Explanation:

It happens when your body fat percentage is going down while gaining muscle. If your body fat percentage is going down but not your weight, you'll be dropping inches in no time, and this is an indication that you are moving in the right direction.

3 0
4 years ago
What is mariculture?
vlabodo [156]

Answer:

A. farming of coral organisms for trade

Explanation:

Your welcome

5 0
3 years ago
Read 2 more answers
Describe the role of enzymes in seeds germination​
Allushta [10]
During germination, seeds use sugars and other molecules as a substrate for respiration. α-amylase and β-amylase are involved in degradation of endosperm starch. Starch hydrolysis into glucose is catalyzed by action of α- and β-amylases, debranching enzyme and α-glucosidases (maltase)
8 0
3 years ago
Teeth patterns in animals and thorns in plants are examples of characteristics which a taxonomist might observe for keying. True
IrinaVladis [17]

The answer is true.

3 0
4 years ago
Why do all microorganisms produce pyruvate via glycolysis?
liraira [26]

Answer:

B) All microorganisms do not produce glucose via glycolysis,

there are alternate pathways that produce glucose.

4 0
3 years ago
Other questions:
  • What would happen if there were no predators on the forest?
    8·1 answer
  • Matter and energy move among plants, animals, decomposers, and the environment within an ecosystem. Through photosynthesis, plan
    7·2 answers
  • Which type of selection tends to increase genetic variation? a. Disruptive selection b. Stabilizing selection c. Directional sel
    12·2 answers
  • What is a promoter? (in biology)
    12·2 answers
  • Which gas giants have a ring system? Select all that apply. A. Saturn B. Jupiter C. Uranus D. Neptune
    9·1 answer
  • What is the part of the brain on the sides?
    6·1 answer
  • Water molecules attract other water molecules and tend to pile up via? Adhesion, vaporization, dissociation, cohesion
    15·1 answer
  • 9. Because the sun heats sections of the Earth more or less, and hot
    15·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Question 3 of 5 Which two statements describe how soil horizons are formed?​
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!