1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alona [7]
3 years ago
11

Which table represents the same proportional relationship as the equation y=36x?

Mathematics
1 answer:
bulgar [2K]3 years ago
7 0

Answer: The third one

C.

Step-by-step explanation:

You might be interested in
Devin is collecting signatures for a petition to open a new park in her town. She needs to collect at least 1,000 signatures bef
san4es73 [151]

Answer:

B) 8 ≤ p

Step-by-step explanation:

1000 - 380 = 620

620 / 80 = 7.75

Round it up to 8

3 0
3 years ago
Read 2 more answers
A tin is a right circular cylinder with a diameter of 6 meters and a height of 10 meters. What is the surface area of this tin,
Alex777 [14]

Answer:

245.04

Step-by-step explanation:

A=2πrh+2πr2=2·π·3·10+2·π·32≈245.04423

Divide 6 by 2 to find the radius

5 0
3 years ago
During an election, Albert received 60% of the 30 votes cast. Anthony received the remaining votes. How many more votes did Albe
r-ruslan [8.4K]

Answer:

6 votes!

Step-by-step explanation:

Albert: 60% of 30= 18

Anthony: 40% of 30= 12

18 - 12= 6

4 0
3 years ago
A stack of six bricks is two feet high. How many bricks are in a stack of 20 feet high? How high is a stack of 20 bricks?
Flura [38]
I believe it is 7 feet high
5 0
3 years ago
Read 2 more answers
Ms. jada wants to save money for her spring break trip. She already has $400 saved in her account. She needs $1600 for the entir
valkas [14]

Answer:

1600-400

=1200

1200/300

=4 months

3 0
3 years ago
Read 2 more answers
Other questions:
  • Express in logarithmic form for the base.. . 4^2=16
    10·2 answers
  • heather writes the equations below to represent two lines drawn on the coordinate plane. –6x 18y = 0 4x – 12y = 20 after applyin
    5·2 answers
  • Find x<br><br> Need gelppppppppppp
    5·1 answer
  • What are to decimals whose product is close to 10
    15·2 answers
  • A random sample of 400 Michigan State University (MSU) students were surveyed recently to determine an estimate for the proporti
    6·1 answer
  • Which system of inequalities is represented by the graph? i need help on this for a test
    7·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • How many crunches will he do on day n?
    6·1 answer
  • Write the explicit formula for the arithmetic sequence.
    11·1 answer
  • Pls help i really need a math professional im struggling.​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!