Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Nerve cells are called neurons . They are adapted to carry electrical impulses from one place to another. ... at each end of the neuron are tiny branches (dendrons ), which branch even further into dendrites . The dendrites receive incoming nerve impulses from other neurons
Differentiation->Fertilization->Gamete Production-Mitosis
<span>Fertilization->Differentiation->Gamete Production->Mitosis </span>
<span>Gamete Production->Fertilization->Mitosis->Diff... </span>
<span>Mitosis->Fertilization->Gamete Production->Differentiation </span>
Answer:
The relationship between a child (sub) class and a parent (super) class is referred to as an is-a relationship
Of human genome codes for protein? 1 percent
