1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
padilas [110]
3 years ago
11

What negative affects do humans have on the earths oceans

Biology
1 answer:
9966 [12]3 years ago
7 0

Answer:

many

pollution by dumping chemical that are harmful to the animals

littering by plastic

accidentally introducing invasive species

over fishing

it lowers the biodiversity of the aquatic ecosystems living there

Explanation:

You might be interested in
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
How are Nerve cells suited for their job?
natita [175]

Answer:

Nerve cells are called neurons . They are adapted to carry electrical impulses from one place to another. ... at each end of the neuron are tiny branches (dendrons ), which branch even further into dendrites . The dendrites receive incoming nerve impulses from other neurons

4 0
3 years ago
Read 2 more answers
What is the sequence of sexual reproduction
Vilka [71]
Differentiation->Fertilization->Gamete Production-Mitosis 

<span>Fertilization->Differentiation->Gamete Production->Mitosis </span>

<span>Gamete Production->Fertilization->Mitosis->Diff... </span>
<span>Mitosis->Fertilization->Gamete Production->Differentiation </span>
8 0
3 years ago
The relationship between a child (sub) class and a parent (super) class is referred to as a(n) ____ relationship.
iris [78.8K]

Answer:

The relationship between a child (sub) class and a parent (super) class is referred to as an is-a relationship

8 0
3 years ago
What percentage of the human genome codes for protein?.
sertanlavr [38]
Of human genome codes for protein? 1 percent
5 0
2 years ago
Read 2 more answers
Other questions:
  • The Clean Air Act imposes permit requirements for stationary sources of pollution. Which states are most likely to oppose strict
    8·2 answers
  • What refers to the safe disposal of mis assets at the end of their life cycle? energy consumption sustainable mis ewaste carbon
    11·1 answer
  • O Excretory System 4. The allows us to breathe, digest food, and react to stimuli by regulating the functions of our organs. (10
    12·1 answer
  • Which branch of biology examines the form and variety of organisms in their natural environment?
    6·1 answer
  • Phosphorous is an important component in which of the following?
    6·1 answer
  • Why is the digestive system broken into many parts
    6·1 answer
  • Identify the error in the following statement: “Photosynthesis is a chemical reaction that takes place in the chloroplasts of gr
    10·2 answers
  • What DNA sequence would code for the amino acid methionine?​
    9·1 answer
  • DO NOW: Name all the parts of this plant
    13·1 answer
  • WILL GIVE BRAINLY IF CORRECT HELPPPPPP
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!