1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sphinxa [80]
3 years ago
5

Is heredity something that can be changed? Explain

Biology
2 answers:
rjkz [21]3 years ago
7 0

Answer:

No

Explanation:

Because it is traits passed down through your DNA. It is nothing something that can be changed. Heredity means a trait you have that was passed from an ancestor. You cannot change that.

kolbaska11 [484]3 years ago
5 0

Answer:

No, Heredity, also called inheritance or biological inheritance, is the passing on of traits from parents to their offspring; either through asexual reproduction or sexual reproduction, the offspring cells or organisms acquire the genetic information of their parents.

Explanation:

You might be interested in
What do you think would happen to the cell cycle if interphase was skipped
Margarita [4]

Answer:

If mitosis skipped any of the stages, it would result in a mutated cell. If the cell skipped Metaphase, it could make daughter cells that are different than the parent cells. If the cell skipped Telophase, the cell would not divide, and the parent cell would attempt interphase with another nucleus.

Explanation:

The cell cycle has two main phases, interphase and mitosis. Mitosis is the process during which one cell divides into two. Interphase is the time during which preparations for mitosis are made.

6 0
3 years ago
What is the job of the protons (H+) in the ETC?
JulsSmile [24]

Answer:

The proton gradient produced by proton pumping during the electron transport chain is used to synthesize ATP. Protons flow down their concentration gradient into the matrix through the membrane protein ATP synthase, causing it to spin (like a water wheel) and catalyze conversion of ADP to ATP. Hope this helps!

Explanation:

Possible brainliest?

3 0
3 years ago
Made up of one or more cells
zheka24 [161]
An organism
because ALL organisms are made up of one or more cells! i hope this helped
8 0
3 years ago
Why must most antibiotics be given some time to take effect on a disease-causing population of bacteria?
Eva8 [605]
The correct answer is d. "Regeneration" means "forming new cells," and signifies that the disease-causing bacteria cells are multiplying. When there are more of these cells, there is a higher chance for antibiotic resistance (making it take longer for the antibiotics to work). Once there is a smaller concentration of these bacterial cells, the antibiotics become more effective. 
8 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Other questions:
  • An empty 1,000.-milliliter container has a mass of 250.0 grams. When filled with a liquid, the container and the liquid have a c
    12·1 answer
  • What happens to productivity as rainfall increases?
    15·1 answer
  • Humans are able to digest cellulose even though we lack the digestive enzymes to break the bond linking the glucose molecules.
    5·1 answer
  • What analogy can you create that compares to the structure of all four major macromolecules?
    11·1 answer
  • A cylinder with a mass of 12 g has a radius measuring 2 cm and a height of 6 cm. What is its density?
    9·2 answers
  • The apoplast in plant tissues consists of:________. a. cell walls, extracellular spaces, and vessel elements b. cell walls, extr
    13·1 answer
  • Which of the following occurred before the Cambrian explosion?
    13·2 answers
  • Could someone help pleaseee
    9·1 answer
  • Which 'if any' of the following are true? Aquatic animals present a greater risk to divers than any other factor. Most aquatic a
    15·1 answer
  • Where does your blood become oxygenated ("picks up" oxygen)?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!