1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vazorg [7]
3 years ago
13

Most water molecules cannot freely cross the cell membrane. True or false?

Biology
2 answers:
MA_775_DIABLO [31]3 years ago
5 0
I believe that's true
ziro4ka [17]3 years ago
3 0
I think that's false.
You might be interested in
he typical human adult uses about 160 g of glucose per day, 120 g of which is used by the brain. The available reserve of glucos
evablogger [386]

Answer:

In humans, the major precursors from which glucose can be synthesized from are:

1. glycerol from triacylglycerols

2. glucogenic amino acids from protein.

3. Oxaloacetate formed from CO2

4. Pyruvate foem pyruvate carboxykinase

All there's are routes through which the body obtains glucose to replenish body glucose levels

3 0
2 years ago
Read 2 more answers
How are carbohydrate polymers formed?
Lostsunrise [7]
The are formed by cells building carbohydrates polymers, they use energy to form glycosidic linkages..the bonds between monosaccarides...which is made by joining two specific monomers, glucose and fructose.

8 0
3 years ago
Select the correct statement about the heart valves. a. The tricuspid valve divides the left atrium from the left ventricle. b.
sleet_krkn [62]
D) The AV valves are supported by chordae tendineae so that they do not blow back up into the atria during ventricular contraction.
3 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
Imagine that a rancher has a herd of cattle with brown hides and short horns. All of his cattle are also relatively short in sta
dmitriy555 [2]

Answer:

The correct answer would be option D.

Explanation:

True breeding is a breeding procedure in which the parents would always produce their progeny with the same phenotype characters as the parents carry. This means for every trait these parents are homozygous so their offspring must show a similar phenotype.

In this case, all cattle are true-breeding which means they homozygous alleles show the progeny will also show similar traits which are short stature with brown hides and short horns.

Thus, the correct answer is option D.

3 0
2 years ago
Other questions:
  • Which hormone is used in testing for pregnancy?
    11·1 answer
  • While performing an assessment of a patient who has diarrhea, the nurse learns that the patient has been using herbal medication
    9·1 answer
  • Which statement best describes the function of arteries, veins, and capillaries in the circulatory system?
    11·1 answer
  • What do we call an organized profile of a person's chromosomes?
    15·1 answer
  • Dalton’s atomic theory stated that every element was made of atoms that could not be subdivided, atoms of the same element are a
    14·2 answers
  • Which group of organisms is most closely related to Archeabacteria?
    14·2 answers
  • What type of mutation results in frameshift mutation?
    13·1 answer
  • Which is true of a step down transformer but not a step up transformer
    13·1 answer
  • PLEASE HELP IM IN EXAMS RIGHT NOW Which is not true about natural selection?
    9·1 answer
  • G proteins are enzymes that bind and hydrolyze GTP to GDP. They are regulated by associated proteins that induce the binding of
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!