1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zimovet [89]
3 years ago
15

Grasslands with scattered trees is called

Biology
2 answers:
mamaluj [8]3 years ago
7 0

They are usually called Savannas, sometimes they are also called Prairies

Leona [35]3 years ago
5 0

grasslands with scattered tress is called savannas

You might be interested in
If, someday, an archaean cell is discovered whose rRNA sequence is more similar to that of humans than the sequence of mouse rRN
Wewaii [24]

Answer:

<h2>homoplasy</h2>

Explanation:

Homoplasy:  the character that is present in the set of species but not present in their common ancestors is known as homoplasy. In case of an archaean cell, their rRNA sequence is more similar to that of humans than the sequence of mouse rRNA is to that of humans.

Example: the evolution of the eye which has originated independently in many unrelated species.

7 0
3 years ago
HELP! ANSWER IF YOU KNOW!!
Zarrin [17]

A is the correct answer

8 0
4 years ago
Why does the climate in the southern hemisphere tend to be milder than the northern
zheka24 [161]

Answer:

Because the Southern Hemisphere has more ocean and much less land. As you may know water heats up and cools down more slowly than land.

3 0
3 years ago
When controlled, _______________ can lessen the risk of contracting cardiovascular disease.
viktelen [127]
The answer is A because







6 0
3 years ago
The sliding filament theory is used to explain the physiology of skeletal muscle contraction. On your own, write your own descri
docker41 [41]

It is the process of muscle contraction involving the sliding of actin & myosin myofilaments past each other to shorten the length of each sacromere.

4 0
3 years ago
Other questions:
  • Fiona wanted to determined sugar water afected the growth rate of bean plant seeds. She buried a total of 12 bean plant seeds, e
    10·2 answers
  • Dr. calvin admitted ms. jones, and after taking a comprehensive history, he completed a comprehensive examination and medical de
    5·1 answer
  • What biome does a hippo live in
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Where are the longest continuous mountain ranges on earth located?
    13·2 answers
  • Explain how fertilization produces a new individual
    7·2 answers
  • Some athletes will consume a large amount of carbohydrates known as carbo loading. Why would this be advantageous to an athlete
    13·1 answer
  • Last month, Sarah documented how her city suffered from acid rain. What type of pollution should the people in Sarah’s city try
    15·2 answers
  • Can anyone help for question 6?
    12·1 answer
  • What gases are present on Earth as it finished forming?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!