1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetlanka [38]
4 years ago
7

Which example shows a physical change taking place?

Biology
1 answer:
Black_prince [1.1K]4 years ago
8 0

Answer:

Chemical Reaction, maybe

Explanation:

You might be interested in
How the metric system came to be
leva [86]

Answer The first practical realisation of the metric system came in 1799, during the French Revolution, when the existing system of measures

Explanation:

8 0
3 years ago
Read 2 more answers
During which months do both the Northern and Southern Hemispheres receive the same amount of energy from the Sun?
Likurg_2 [28]
They recive the most in July and June
4 0
4 years ago
Read 2 more answers
Explain the relationship between societyand the technologies of using Earth'sresources.
Advocard [28]
Well for one, we used coal for electricity, water for steam engines when they were much in use, natural fossil feuls for our gasoline and oil, and we use earths oxygen/nitrogen gasses to breathe and sadly we are polluting it at a fast rate
8 0
3 years ago
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
"viral reverse transcriptase to make a DNA copy that is integrated into the host genome and then host RNA polymerase transcribes
mihalych1998 [28]

Answer:

"Viral reverse transcriptase to make a DNA copy that is integrated into the host genome and then host RNA polymerase transcribes it is a true statement.

Explanation:

The virus is an infectious agent which is not considered living either considered non- living. The virus particles contain the genetic material that determines the trait of a virus in the form of either DNA or RNA.

The virus which contains the RNA replicates themselves by fist converting their RNA into DNA by reverse transcriptase enzyme. Once the DNA is made, the DNA is incorporated in the genome of the host and the machinery of the host performs the replication, transcription and translation.

Thus, the selected option is true.

5 0
3 years ago
Other questions:
  • Which of the following is NOT one of the four common causes for people falling and hurting themselves in the automotive repair i
    8·2 answers
  • How would the contractile vacuole of a freshwater amoeba respond if the organism was placed in seawater
    5·2 answers
  • As energy moves through an ecosystem,
    10·1 answer
  • Multicellular organisms have nervous systems, made up of nerve cells, which help to generate behaviors. The nerve cells througho
    10·1 answer
  • PLEASE HELP!!!
    14·1 answer
  • The sun shinning on thr surface of a lake can heat up the air just above the water.What happens if this air gets warmer then the
    14·2 answers
  • How are the processes of asexual reproduction and sexual reproduction different? Select three options.
    8·2 answers
  • What would most likely happen to a person who is not getting enough essential amino acids in his or her diet?
    13·1 answer
  • Fill in the blank: Muscles work in _____ pairs.
    15·1 answer
  • The table below shows the depths at which an index fossil and three other fossils were found. Which statement is correct?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!