That is part of a cow when it has ate something with cocoa.
Four chambered heart keeps oxygenated and deoxygenated blood separate and has double circulation while three chambered heart has a single circulation. Two chambered heart only has single atrium and single ventricle
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
The importance of conservation of habitats is that habitat conservation protects biodiversity in the region.
<h3>Conservation of habitats</h3>
Habitat can be defined as an environment that is made up of resources that are used by a particular organism.
There are different types of habitat which include:
These habitats needs to be conserved to maintain biodiversity which is an essential part of global food security.
Learn more about biodiversity here:
brainly.com/question/11542363
